Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626483_at:

>probe:Drosophila_2:1626483_at:489:295; Interrogation_Position=3962; Antisense; CGAGATCAGCTCGAAGGCTTCCCAG
>probe:Drosophila_2:1626483_at:638:481; Interrogation_Position=4010; Antisense; GTATCTGCAAAGGAAACCCCATCGT
>probe:Drosophila_2:1626483_at:549:41; Interrogation_Position=4030; Antisense; ATCGTGCAACTCACGGACAGTTCGC
>probe:Drosophila_2:1626483_at:132:131; Interrogation_Position=4065; Antisense; ACCGTCGATGTGAAGCGCGTGCTGC
>probe:Drosophila_2:1626483_at:371:323; Interrogation_Position=4079; Antisense; GCGCGTGCTGCAGATCTAAAAAGGA
>probe:Drosophila_2:1626483_at:628:545; Interrogation_Position=4101; Antisense; GGATCGTGTATCGTGGCAATGGAAT
>probe:Drosophila_2:1626483_at:526:667; Interrogation_Position=4166; Antisense; TACTGCTAGCACAATTTCGGATCCC
>probe:Drosophila_2:1626483_at:722:545; Interrogation_Position=4184; Antisense; GGATCCCTCGCACAAGCAGCTTAGT
>probe:Drosophila_2:1626483_at:689:207; Interrogation_Position=4197; Antisense; AAGCAGCTTAGTCCAAAATCCAATA
>probe:Drosophila_2:1626483_at:10:167; Interrogation_Position=4212; Antisense; AAATCCAATAACACAGCTCCTCAAG
>probe:Drosophila_2:1626483_at:86:213; Interrogation_Position=4234; Antisense; AAGACTCCCTGCTCCTGTGATGTGA
>probe:Drosophila_2:1626483_at:193:515; Interrogation_Position=4362; Antisense; GTGTTTAACTCCAACAAAGCCTGTT
>probe:Drosophila_2:1626483_at:638:185; Interrogation_Position=4374; Antisense; AACAAAGCCTGTTTCTGATACTAAA
>probe:Drosophila_2:1626483_at:646:145; Interrogation_Position=4398; Antisense; ACTCAAGCGAACTAATACCGGTATT

Paste this into a BLAST search page for me
CGAGATCAGCTCGAAGGCTTCCCAGGTATCTGCAAAGGAAACCCCATCGTATCGTGCAACTCACGGACAGTTCGCACCGTCGATGTGAAGCGCGTGCTGCGCGCGTGCTGCAGATCTAAAAAGGAGGATCGTGTATCGTGGCAATGGAATTACTGCTAGCACAATTTCGGATCCCGGATCCCTCGCACAAGCAGCTTAGTAAGCAGCTTAGTCCAAAATCCAATAAAATCCAATAACACAGCTCCTCAAGAAGACTCCCTGCTCCTGTGATGTGAGTGTTTAACTCCAACAAAGCCTGTTAACAAAGCCTGTTTCTGATACTAAAACTCAAGCGAACTAATACCGGTATT

Full Affymetrix probeset data:

Annotations for 1626483_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime