FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626485_at:

>probe:Drosophila_2:1626485_at:528:5; Interrogation_Position=1030; Antisense; ATTGCAGCAGGTGACACGACCGCAT
>probe:Drosophila_2:1626485_at:690:129; Interrogation_Position=1048; Antisense; ACCGCATTCAGCAGTCAGTGGGCTT
>probe:Drosophila_2:1626485_at:499:407; Interrogation_Position=1109; Antisense; GACTGGCCAAGGAGCGAGCTACCAA
>probe:Drosophila_2:1626485_at:413:117; Interrogation_Position=1125; Antisense; AGCTACCAATGATTCTCGCCTGATG
>probe:Drosophila_2:1626485_at:726:603; Interrogation_Position=1157; Antisense; TGATCAAGGAGTCCCTGCGTCTGTA
>probe:Drosophila_2:1626485_at:231:647; Interrogation_Position=1196; Antisense; TCATTGGCCGATATCTGCCGCAGGA
>probe:Drosophila_2:1626485_at:543:359; Interrogation_Position=1224; Antisense; GCAACTTGGCGGTCACTTTATCGAA
>probe:Drosophila_2:1626485_at:129:171; Interrogation_Position=1248; Antisense; AAAGGATACCATGGTGCTGCTCTCC
>probe:Drosophila_2:1626485_at:40:723; Interrogation_Position=1273; Antisense; TTGTACACGGCAGGTCGCGATCCAT
>probe:Drosophila_2:1626485_at:249:33; Interrogation_Position=1296; Antisense; ATCACACTTTGAGCAGCCGGAACGT
>probe:Drosophila_2:1626485_at:562:533; Interrogation_Position=1359; Antisense; GGTGCATAAGTCACACGGCAGTCTG
>probe:Drosophila_2:1626485_at:121:319; Interrogation_Position=1454; Antisense; GCCGATGTGCTGCTCAGTTTGAGAT
>probe:Drosophila_2:1626485_at:326:57; Interrogation_Position=1477; Antisense; ATGAGCTGCCTTAACGAGATGCCCG
>probe:Drosophila_2:1626485_at:233:507; Interrogation_Position=1528; Antisense; GTGCCCGATCGGACTTTGCGTTTAG

Paste this into a BLAST search page for me
ATTGCAGCAGGTGACACGACCGCATACCGCATTCAGCAGTCAGTGGGCTTGACTGGCCAAGGAGCGAGCTACCAAAGCTACCAATGATTCTCGCCTGATGTGATCAAGGAGTCCCTGCGTCTGTATCATTGGCCGATATCTGCCGCAGGAGCAACTTGGCGGTCACTTTATCGAAAAAGGATACCATGGTGCTGCTCTCCTTGTACACGGCAGGTCGCGATCCATATCACACTTTGAGCAGCCGGAACGTGGTGCATAAGTCACACGGCAGTCTGGCCGATGTGCTGCTCAGTTTGAGATATGAGCTGCCTTAACGAGATGCCCGGTGCCCGATCGGACTTTGCGTTTAG

Full Affymetrix probeset data:

Annotations for 1626485_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720