FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626486_at:

>probe:Drosophila_2:1626486_at:258:613; Interrogation_Position=1478; Antisense; TGAAAACTTTGGGTCGACATCGATT
>probe:Drosophila_2:1626486_at:473:25; Interrogation_Position=1508; Antisense; ATAGCTATATAGGTCCCGTGGGAGA
>probe:Drosophila_2:1626486_at:442:387; Interrogation_Position=1538; Antisense; GAACAACACGTACTCACATTCTTAT
>probe:Drosophila_2:1626486_at:26:685; Interrogation_Position=1560; Antisense; TATAAGAGACTTGATCGCCAGAAAA
>probe:Drosophila_2:1626486_at:604:541; Interrogation_Position=1679; Antisense; TGAAAACCGCCCAGGAGATTTCCCG
>probe:Drosophila_2:1626486_at:110:95; Interrogation_Position=1694; Antisense; AGATTTCCCGGCTTTACAATGTCAT
>probe:Drosophila_2:1626486_at:376:497; Interrogation_Position=1714; Antisense; GTCATTGTTCAGACACCGTCAGATG
>probe:Drosophila_2:1626486_at:70:133; Interrogation_Position=1728; Antisense; ACCGTCAGATGAACCAATTCCTTGG
>probe:Drosophila_2:1626486_at:124:343; Interrogation_Position=1782; Antisense; TCCAAAGGTTCCAAAAGCCTCCAAG
>probe:Drosophila_2:1626486_at:672:217; Interrogation_Position=1804; Antisense; AAGTCGCCCAGAAAATACTTGGCCG
>probe:Drosophila_2:1626486_at:302:581; Interrogation_Position=1823; Antisense; TGGCCGACCAAGACGCAATGGTTTT
>probe:Drosophila_2:1626486_at:347:477; Interrogation_Position=1843; Antisense; GTTTTCCACGAACCTTTTGATCATA
>probe:Drosophila_2:1626486_at:268:195; Interrogation_Position=1873; Antisense; AACTGGACCTGGCAACGGCGACAAT
>probe:Drosophila_2:1626486_at:191:445; Interrogation_Position=1996; Antisense; GATGAGGCTTCAATTCATTCGTCAT

Paste this into a BLAST search page for me
TGAAAACTTTGGGTCGACATCGATTATAGCTATATAGGTCCCGTGGGAGAGAACAACACGTACTCACATTCTTATTATAAGAGACTTGATCGCCAGAAAATGAAAACCGCCCAGGAGATTTCCCGAGATTTCCCGGCTTTACAATGTCATGTCATTGTTCAGACACCGTCAGATGACCGTCAGATGAACCAATTCCTTGGTCCAAAGGTTCCAAAAGCCTCCAAGAAGTCGCCCAGAAAATACTTGGCCGTGGCCGACCAAGACGCAATGGTTTTGTTTTCCACGAACCTTTTGATCATAAACTGGACCTGGCAACGGCGACAATGATGAGGCTTCAATTCATTCGTCAT

Full Affymetrix probeset data:

Annotations for 1626486_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720