Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626490_s_at:

>probe:Drosophila_2:1626490_s_at:333:159; Interrogation_Position=101; Antisense; ACAAGCGCAGAATCAAAGCCCGGAT
>probe:Drosophila_2:1626490_s_at:710:255; Interrogation_Position=114; Antisense; CAAAGCCCGGATTTTAGCTAAGCAA
>probe:Drosophila_2:1626490_s_at:154:255; Interrogation_Position=131; Antisense; CTAAGCAAACGGGAGCTACTCAATT
>probe:Drosophila_2:1626490_s_at:583:177; Interrogation_Position=137; Antisense; AAACGGGAGCTACTCAATTCGAGGA
>probe:Drosophila_2:1626490_s_at:210:553; Interrogation_Position=142; Antisense; GGAGCTACTCAATTCGAGGAGGAAC
>probe:Drosophila_2:1626490_s_at:59:437; Interrogation_Position=157; Antisense; GAGGAGGAACGCTATGAGGCCCATA
>probe:Drosophila_2:1626490_s_at:175:683; Interrogation_Position=169; Antisense; TATGAGGCCCATACGAACTGCAATG
>probe:Drosophila_2:1626490_s_at:66:71; Interrogation_Position=173; Antisense; AGGCCCATACGAACTGCAATGAACA
>probe:Drosophila_2:1626490_s_at:305:361; Interrogation_Position=188; Antisense; GCAATGAACACAAGCACCACTTAAA
>probe:Drosophila_2:1626490_s_at:638:319; Interrogation_Position=201; Antisense; GCACCACTTAAAGAAGCGTGCTTCT
>probe:Drosophila_2:1626490_s_at:306:377; Interrogation_Position=213; Antisense; GAAGCGTGCTTCTGATGAGGATGTT
>probe:Drosophila_2:1626490_s_at:177:343; Interrogation_Position=220; Antisense; GCTTCTGATGAGGATGTTGATTACG
>probe:Drosophila_2:1626490_s_at:379:5; Interrogation_Position=77; Antisense; ATTGTACTGGTAATCCTTGGCTATA
>probe:Drosophila_2:1626490_s_at:550:493; Interrogation_Position=86; Antisense; GTAATCCTTGGCTATACAAGCGCAG

Paste this into a BLAST search page for me
ACAAGCGCAGAATCAAAGCCCGGATCAAAGCCCGGATTTTAGCTAAGCAACTAAGCAAACGGGAGCTACTCAATTAAACGGGAGCTACTCAATTCGAGGAGGAGCTACTCAATTCGAGGAGGAACGAGGAGGAACGCTATGAGGCCCATATATGAGGCCCATACGAACTGCAATGAGGCCCATACGAACTGCAATGAACAGCAATGAACACAAGCACCACTTAAAGCACCACTTAAAGAAGCGTGCTTCTGAAGCGTGCTTCTGATGAGGATGTTGCTTCTGATGAGGATGTTGATTACGATTGTACTGGTAATCCTTGGCTATAGTAATCCTTGGCTATACAAGCGCAG

Full Affymetrix probeset data:

Annotations for 1626490_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime