FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626491_at:

>probe:Drosophila_2:1626491_at:630:425; Interrogation_Position=1063; Antisense; GAGTTTTTCCTTATGGACTTTCGCA
>probe:Drosophila_2:1626491_at:376:5; Interrogation_Position=1088; Antisense; ATTGTCCATTCTGTAAGGCACCCAT
>probe:Drosophila_2:1626491_at:437:493; Interrogation_Position=1128; Antisense; GTCACCTATCAGCTGGGAGACAATA
>probe:Drosophila_2:1626491_at:15:377; Interrogation_Position=1162; Antisense; GAAGAAGCCGAATTGCCCAGTGATG
>probe:Drosophila_2:1626491_at:158:425; Interrogation_Position=1208; Antisense; GAGACTCAGCTGCATGTTACCTTAA
>probe:Drosophila_2:1626491_at:91:609; Interrogation_Position=1307; Antisense; TGAGTTTGATTGTCCCTTGGCCCAC
>probe:Drosophila_2:1626491_at:135:275; Interrogation_Position=1322; Antisense; CTTGGCCCACATGTCAGTATTCATT
>probe:Drosophila_2:1626491_at:597:557; Interrogation_Position=1395; Antisense; GGACATGACCACGATAAACCCTTAT
>probe:Drosophila_2:1626491_at:375:27; Interrogation_Position=1418; Antisense; ATAGCCCAGTCTGCAGATTGGCACT
>probe:Drosophila_2:1626491_at:509:347; Interrogation_Position=1481; Antisense; GCATGAGCTTACAGCTGTTTCCAAA
>probe:Drosophila_2:1626491_at:4:669; Interrogation_Position=1523; Antisense; TACTTCCCAGTACTTCAGTTCGCAA
>probe:Drosophila_2:1626491_at:227:469; Interrogation_Position=1540; Antisense; GTTCGCAAGAATTTCCACGTACTAA
>probe:Drosophila_2:1626491_at:596:529; Interrogation_Position=1567; Antisense; GGGTAACTAGACTGCGCTTCTCTCT
>probe:Drosophila_2:1626491_at:314:343; Interrogation_Position=1582; Antisense; GCTTCTCTCTCAACATGCTGATACA

Paste this into a BLAST search page for me
GAGTTTTTCCTTATGGACTTTCGCAATTGTCCATTCTGTAAGGCACCCATGTCACCTATCAGCTGGGAGACAATAGAAGAAGCCGAATTGCCCAGTGATGGAGACTCAGCTGCATGTTACCTTAATGAGTTTGATTGTCCCTTGGCCCACCTTGGCCCACATGTCAGTATTCATTGGACATGACCACGATAAACCCTTATATAGCCCAGTCTGCAGATTGGCACTGCATGAGCTTACAGCTGTTTCCAAATACTTCCCAGTACTTCAGTTCGCAAGTTCGCAAGAATTTCCACGTACTAAGGGTAACTAGACTGCGCTTCTCTCTGCTTCTCTCTCAACATGCTGATACA

Full Affymetrix probeset data:

Annotations for 1626491_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720