Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626494_at:

>probe:Drosophila_2:1626494_at:325:485; Interrogation_Position=2468; Antisense; GTAGACATGCCGGAACACTTAGACT
>probe:Drosophila_2:1626494_at:393:559; Interrogation_Position=2479; Antisense; GGAACACTTAGACTACCACGTAGCC
>probe:Drosophila_2:1626494_at:66:487; Interrogation_Position=2498; Antisense; GTAGCCAGAAACCTTCAACGTGAAC
>probe:Drosophila_2:1626494_at:182:253; Interrogation_Position=2513; Antisense; CAACGTGAACTAAACCAGCAGGATC
>probe:Drosophila_2:1626494_at:528:383; Interrogation_Position=2541; Antisense; GAACTCGAACCGCAGCTCTGAATAA
>probe:Drosophila_2:1626494_at:241:181; Interrogation_Position=2569; Antisense; AAAAATATCTCCAGTTCAGCCAAAG
>probe:Drosophila_2:1626494_at:428:203; Interrogation_Position=2620; Antisense; AACCATTTCTGCATCTTCAAGCGGA
>probe:Drosophila_2:1626494_at:575:247; Interrogation_Position=2653; Antisense; AATTGCCCAGTTTTTCAGCCAAAGC
>probe:Drosophila_2:1626494_at:403:249; Interrogation_Position=2677; Antisense; CAATTAGAGAAACCCTTACACCGCT
>probe:Drosophila_2:1626494_at:160:157; Interrogation_Position=2694; Antisense; ACACCGCTCCAAGTATTTGAACCTG
>probe:Drosophila_2:1626494_at:89:659; Interrogation_Position=2721; Antisense; TAAGTACCTACGAATGGACCACAGA
>probe:Drosophila_2:1626494_at:165:39; Interrogation_Position=2843; Antisense; ATCTCAATCTGGCTCTGGACAGCAA
>probe:Drosophila_2:1626494_at:330:705; Interrogation_Position=3003; Antisense; TTACCATTACCATCCATCCGTTAAT
>probe:Drosophila_2:1626494_at:238:187; Interrogation_Position=3034; Antisense; AACACAACGCTCTGTCAATGCTAAA

Paste this into a BLAST search page for me
GTAGACATGCCGGAACACTTAGACTGGAACACTTAGACTACCACGTAGCCGTAGCCAGAAACCTTCAACGTGAACCAACGTGAACTAAACCAGCAGGATCGAACTCGAACCGCAGCTCTGAATAAAAAAATATCTCCAGTTCAGCCAAAGAACCATTTCTGCATCTTCAAGCGGAAATTGCCCAGTTTTTCAGCCAAAGCCAATTAGAGAAACCCTTACACCGCTACACCGCTCCAAGTATTTGAACCTGTAAGTACCTACGAATGGACCACAGAATCTCAATCTGGCTCTGGACAGCAATTACCATTACCATCCATCCGTTAATAACACAACGCTCTGTCAATGCTAAA

Full Affymetrix probeset data:

Annotations for 1626494_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime