FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626496_at:

>probe:Drosophila_2:1626496_at:137:383; Interrogation_Position=1015; Antisense; GAACGTTCCTTTAGCATATCCTCGA
>probe:Drosophila_2:1626496_at:67:41; Interrogation_Position=1040; Antisense; ATCTGCAGCGCCATGTGCGGAATAT
>probe:Drosophila_2:1626496_at:635:75; Interrogation_Position=1073; Antisense; AGGAGCGACCCTTCAAGTGTGAGAT
>probe:Drosophila_2:1626496_at:137:683; Interrogation_Position=1097; Antisense; TATGCGAGAGATGCTTTGGCCAACA
>probe:Drosophila_2:1626496_at:307:401; Interrogation_Position=1132; Antisense; GACAGGCACCTCAAGAAGCACGAGT
>probe:Drosophila_2:1626496_at:155:209; Interrogation_Position=1147; Antisense; AAGCACGAGTCGGATGCGGTGTCCT
>probe:Drosophila_2:1626496_at:307:51; Interrogation_Position=1160; Antisense; ATGCGGTGTCCTTGAGTGCCTTGTC
>probe:Drosophila_2:1626496_at:307:77; Interrogation_Position=1253; Antisense; AGGAGATACGCAGCTTCATGGGCAA
>probe:Drosophila_2:1626496_at:521:647; Interrogation_Position=1268; Antisense; TCATGGGCAAGGTCACGCAGCAACA
>probe:Drosophila_2:1626496_at:347:359; Interrogation_Position=1351; Antisense; GCAACATCGGCGTCCAGTTCGTGCT
>probe:Drosophila_2:1626496_at:491:463; Interrogation_Position=1486; Antisense; GATTCGCAGCCGATCATGGAGCTCA
>probe:Drosophila_2:1626496_at:504:61; Interrogation_Position=1501; Antisense; ATGGAGCTCAAGAGGACCCTTACCT
>probe:Drosophila_2:1626496_at:253:147; Interrogation_Position=1543; Antisense; ACTACCGCAGACAGCGCGATGACGA
>probe:Drosophila_2:1626496_at:619:411; Interrogation_Position=1566; Antisense; GACGCCCCAAACAACATCTATCAAG

Paste this into a BLAST search page for me
GAACGTTCCTTTAGCATATCCTCGAATCTGCAGCGCCATGTGCGGAATATAGGAGCGACCCTTCAAGTGTGAGATTATGCGAGAGATGCTTTGGCCAACAGACAGGCACCTCAAGAAGCACGAGTAAGCACGAGTCGGATGCGGTGTCCTATGCGGTGTCCTTGAGTGCCTTGTCAGGAGATACGCAGCTTCATGGGCAATCATGGGCAAGGTCACGCAGCAACAGCAACATCGGCGTCCAGTTCGTGCTGATTCGCAGCCGATCATGGAGCTCAATGGAGCTCAAGAGGACCCTTACCTACTACCGCAGACAGCGCGATGACGAGACGCCCCAAACAACATCTATCAAG

Full Affymetrix probeset data:

Annotations for 1626496_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720