FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626497_at:

>probe:Drosophila_2:1626497_at:685:13; Interrogation_Position=120; Antisense; ATTAAATTCCTTACCAGCTCATACA
>probe:Drosophila_2:1626497_at:688:117; Interrogation_Position=135; Antisense; AGCTCATACAATTCACCGGTCACAA
>probe:Drosophila_2:1626497_at:556:537; Interrogation_Position=152; Antisense; GGTCACAATGCCTTCTTACGAACTA
>probe:Drosophila_2:1626497_at:434:275; Interrogation_Position=163; Antisense; CTTCTTACGAACTAGCACTGGTGCT
>probe:Drosophila_2:1626497_at:325:321; Interrogation_Position=202; Antisense; GCCCCGAACTGATTTCCGTGATTAG
>probe:Drosophila_2:1626497_at:63:605; Interrogation_Position=220; Antisense; TGATTAGGCGAACGGCCGAGTCCAT
>probe:Drosophila_2:1626497_at:308:629; Interrogation_Position=240; Antisense; TCCATCCTGGACAAGGGCGGCATTA
>probe:Drosophila_2:1626497_at:301:589; Interrogation_Position=325; Antisense; TGGTTCACCGGGAAGGCACCCACTT
>probe:Drosophila_2:1626497_at:117:299; Interrogation_Position=370; Antisense; CGCCCACTAAGATCGCAGACTTGAA
>probe:Drosophila_2:1626497_at:314:481; Interrogation_Position=401; Antisense; GTTTGGCCGCGACATCGACATCATA
>probe:Drosophila_2:1626497_at:263:667; Interrogation_Position=424; Antisense; TACGGCGCTACATCTTCAAGGTGGA
>probe:Drosophila_2:1626497_at:508:205; Interrogation_Position=462; Antisense; AAGCCCTGCACGCTGCACGAGGAGA
>probe:Drosophila_2:1626497_at:42:375; Interrogation_Position=554; Antisense; GAAGTTCAACTACAACTCCGGCCTG
>probe:Drosophila_2:1626497_at:584:287; Interrogation_Position=576; Antisense; CTGGACTACTATCCCTTCCAAAAAT

Paste this into a BLAST search page for me
ATTAAATTCCTTACCAGCTCATACAAGCTCATACAATTCACCGGTCACAAGGTCACAATGCCTTCTTACGAACTACTTCTTACGAACTAGCACTGGTGCTGCCCCGAACTGATTTCCGTGATTAGTGATTAGGCGAACGGCCGAGTCCATTCCATCCTGGACAAGGGCGGCATTATGGTTCACCGGGAAGGCACCCACTTCGCCCACTAAGATCGCAGACTTGAAGTTTGGCCGCGACATCGACATCATATACGGCGCTACATCTTCAAGGTGGAAAGCCCTGCACGCTGCACGAGGAGAGAAGTTCAACTACAACTCCGGCCTGCTGGACTACTATCCCTTCCAAAAAT

Full Affymetrix probeset data:

Annotations for 1626497_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720