FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626498_at:

>probe:Drosophila_2:1626498_at:354:555; Interrogation_Position=101; Antisense; GGACCATCAATCAATTAGGCGCCAT
>probe:Drosophila_2:1626498_at:256:679; Interrogation_Position=116; Antisense; TAGGCGCCATTTTGCCTTCCACGAA
>probe:Drosophila_2:1626498_at:38:63; Interrogation_Position=13; Antisense; ATGTCCTTCGTCGTGGATGTGGATG
>probe:Drosophila_2:1626498_at:693:381; Interrogation_Position=138; Antisense; GAACGCGTGCACATGGAATCCGCAT
>probe:Drosophila_2:1626498_at:286:367; Interrogation_Position=153; Antisense; GAATCCGCATCATATTCCTGTTCCT
>probe:Drosophila_2:1626498_at:601:719; Interrogation_Position=173; Antisense; TTCCTGCACCATGTTGCATGTTGCA
>probe:Drosophila_2:1626498_at:34:349; Interrogation_Position=188; Antisense; GCATGTTGCATGGACTGACCTCGCT
>probe:Drosophila_2:1626498_at:130:317; Interrogation_Position=213; Antisense; GCCTCCTGATGACGTCTGCGTGGAA
>probe:Drosophila_2:1626498_at:155:391; Interrogation_Position=235; Antisense; GAAACTATGACGTCACTGGCGGCGA
>probe:Drosophila_2:1626498_at:247:143; Interrogation_Position=249; Antisense; ACTGGCGGCGAAACTAGTGCAAATA
>probe:Drosophila_2:1626498_at:379:207; Interrogation_Position=280; Antisense; AAGCTGCACACGCATGCTATCGGTG
>probe:Drosophila_2:1626498_at:446:267; Interrogation_Position=292; Antisense; CATGCTATCGGTGTGAACGACTGCG
>probe:Drosophila_2:1626498_at:78:509; Interrogation_Position=326; Antisense; GTGCGGTTGCACGTCATCAATGTGG
>probe:Drosophila_2:1626498_at:480:331; Interrogation_Position=86; Antisense; GCGGCGGAGCTTACTGGACCATCAA

Paste this into a BLAST search page for me
GGACCATCAATCAATTAGGCGCCATTAGGCGCCATTTTGCCTTCCACGAAATGTCCTTCGTCGTGGATGTGGATGGAACGCGTGCACATGGAATCCGCATGAATCCGCATCATATTCCTGTTCCTTTCCTGCACCATGTTGCATGTTGCAGCATGTTGCATGGACTGACCTCGCTGCCTCCTGATGACGTCTGCGTGGAAGAAACTATGACGTCACTGGCGGCGAACTGGCGGCGAAACTAGTGCAAATAAAGCTGCACACGCATGCTATCGGTGCATGCTATCGGTGTGAACGACTGCGGTGCGGTTGCACGTCATCAATGTGGGCGGCGGAGCTTACTGGACCATCAA

Full Affymetrix probeset data:

Annotations for 1626498_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720