Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626499_at:

>probe:Drosophila_2:1626499_at:444:497; Interrogation_Position=2513; Antisense; GTCATCACGTGACCGGCGAGAGCCA
>probe:Drosophila_2:1626499_at:181:11; Interrogation_Position=2537; Antisense; ATTCTCCTTACAGTCAGCAATCAAC
>probe:Drosophila_2:1626499_at:438:111; Interrogation_Position=2552; Antisense; AGCAATCAACGCCACAGAGTCAATC
>probe:Drosophila_2:1626499_at:168:495; Interrogation_Position=2609; Antisense; GTCAGATAGTTCAGCCAGTACCCAC
>probe:Drosophila_2:1626499_at:614:87; Interrogation_Position=2644; Antisense; AGTCGCAGCTCCAACACTGAACTGA
>probe:Drosophila_2:1626499_at:388:591; Interrogation_Position=2691; Antisense; TGGTCTGCCAGAGCGATCATCGAAT
>probe:Drosophila_2:1626499_at:474:681; Interrogation_Position=2735; Antisense; TATGGCTTAAGCTACGCACTAAAGT
>probe:Drosophila_2:1626499_at:669:659; Interrogation_Position=2810; Antisense; TAAGCCCTAGCCGTTAGTCATACTA
>probe:Drosophila_2:1626499_at:444:673; Interrogation_Position=2837; Antisense; TAGCCAAGACCAATGTCCCAGTTAG
>probe:Drosophila_2:1626499_at:423:613; Interrogation_Position=2903; Antisense; TAACTGTGCAAATGTCTTCCTCCTT
>probe:Drosophila_2:1626499_at:175:629; Interrogation_Position=2920; Antisense; TCCTCCTTTTAGTCAACTGCTTACA
>probe:Drosophila_2:1626499_at:91:507; Interrogation_Position=2967; Antisense; GTGCCAACCACTTAGGATCGCTATA
>probe:Drosophila_2:1626499_at:246:539; Interrogation_Position=3003; Antisense; GGTAGTTTAGCCCAAGACAGCACAA
>probe:Drosophila_2:1626499_at:270:205; Interrogation_Position=3026; Antisense; AAGCCCATAATGAAGCCTACGATTT

Paste this into a BLAST search page for me
GTCATCACGTGACCGGCGAGAGCCAATTCTCCTTACAGTCAGCAATCAACAGCAATCAACGCCACAGAGTCAATCGTCAGATAGTTCAGCCAGTACCCACAGTCGCAGCTCCAACACTGAACTGATGGTCTGCCAGAGCGATCATCGAATTATGGCTTAAGCTACGCACTAAAGTTAAGCCCTAGCCGTTAGTCATACTATAGCCAAGACCAATGTCCCAGTTAGTAACTGTGCAAATGTCTTCCTCCTTTCCTCCTTTTAGTCAACTGCTTACAGTGCCAACCACTTAGGATCGCTATAGGTAGTTTAGCCCAAGACAGCACAAAAGCCCATAATGAAGCCTACGATTT

Full Affymetrix probeset data:

Annotations for 1626499_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime