Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626500_a_at:

>probe:Drosophila_2:1626500_a_at:638:689; Interrogation_Position=110; Antisense; TATTGGCAACCAAGTGTCGGAATGC
>probe:Drosophila_2:1626500_a_at:358:103; Interrogation_Position=174; Antisense; AGACCTTCCTCAACAATTTCCATAA
>probe:Drosophila_2:1626500_a_at:693:491; Interrogation_Position=230; Antisense; GTAAACACGATTTTGGAGGCCATCA
>probe:Drosophila_2:1626500_a_at:605:15; Interrogation_Position=239; Antisense; ATTTTGGAGGCCATCAGCGCCGAGG
>probe:Drosophila_2:1626500_a_at:722:283; Interrogation_Position=327; Antisense; CTGATTTGGATCATGCGGAGGAAGC
>probe:Drosophila_2:1626500_a_at:240:15; Interrogation_Position=384; Antisense; ATTTCATAGATGACGAGGGCAACTG
>probe:Drosophila_2:1626500_a_at:103:527; Interrogation_Position=400; Antisense; GGGCAACTGCTATATCAAGACTACG
>probe:Drosophila_2:1626500_a_at:116:685; Interrogation_Position=410; Antisense; TATATCAAGACTACGCCCAAGAAGC
>probe:Drosophila_2:1626500_a_at:257:393; Interrogation_Position=481; Antisense; GAAAGCTACACGTTCCGTGGTCAGT
>probe:Drosophila_2:1626500_a_at:397:305; Interrogation_Position=495; Antisense; CCGTGGTCAGTACAGCCACCAATAA
>probe:Drosophila_2:1626500_a_at:710:241; Interrogation_Position=588; Antisense; AATTTGCGGCCAGCCAAATCGACAC
>probe:Drosophila_2:1626500_a_at:584:163; Interrogation_Position=603; Antisense; AAATCGACACCGAAAGCGACTACTT
>probe:Drosophila_2:1626500_a_at:33:393; Interrogation_Position=614; Antisense; GAAAGCGACTACTTCGAAGCCTCCC
>probe:Drosophila_2:1626500_a_at:358:329; Interrogation_Position=88; Antisense; GCGTCCCTTTCAACATATTTTTTAT

Paste this into a BLAST search page for me
TATTGGCAACCAAGTGTCGGAATGCAGACCTTCCTCAACAATTTCCATAAGTAAACACGATTTTGGAGGCCATCAATTTTGGAGGCCATCAGCGCCGAGGCTGATTTGGATCATGCGGAGGAAGCATTTCATAGATGACGAGGGCAACTGGGGCAACTGCTATATCAAGACTACGTATATCAAGACTACGCCCAAGAAGCGAAAGCTACACGTTCCGTGGTCAGTCCGTGGTCAGTACAGCCACCAATAAAATTTGCGGCCAGCCAAATCGACACAAATCGACACCGAAAGCGACTACTTGAAAGCGACTACTTCGAAGCCTCCCGCGTCCCTTTCAACATATTTTTTAT

Full Affymetrix probeset data:

Annotations for 1626500_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime