FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626501_at:

>probe:Drosophila_2:1626501_at:509:379; Interrogation_Position=1037; Antisense; GAACCACGATGTTGTACTTCATTCA
>probe:Drosophila_2:1626501_at:228:637; Interrogation_Position=1075; Antisense; TCGATTTTGTTCACTGCGGGCGGAA
>probe:Drosophila_2:1626501_at:226:563; Interrogation_Position=1096; Antisense; GGAATTTTCCCCATATGTCTAAACA
>probe:Drosophila_2:1626501_at:690:215; Interrogation_Position=1138; Antisense; AAGTTCGCTTTCTCAGTGGTGACCA
>probe:Drosophila_2:1626501_at:370:37; Interrogation_Position=631; Antisense; ATCATATATGTGGTCGTTCTGCGGA
>probe:Drosophila_2:1626501_at:308:545; Interrogation_Position=653; Antisense; GGATCCACATGGAGCTCTTGAGTGA
>probe:Drosophila_2:1626501_at:371:213; Interrogation_Position=685; Antisense; AAGACGCTGCGTACTGATGTGGAAA
>probe:Drosophila_2:1626501_at:431:409; Interrogation_Position=715; Antisense; GACGATCAACATTATGCCGAGCTGG
>probe:Drosophila_2:1626501_at:286:365; Interrogation_Position=772; Antisense; GAATATGGAAACACTCTGCGTCCCA
>probe:Drosophila_2:1626501_at:91:443; Interrogation_Position=810; Antisense; GATGTTCATCCAACTACTATCCGTT
>probe:Drosophila_2:1626501_at:82:683; Interrogation_Position=827; Antisense; TATCCGTTGGCTTACTTTTGGGTCT
>probe:Drosophila_2:1626501_at:330:503; Interrogation_Position=861; Antisense; GTCCATGCAGTTCTATAACACCGTA
>probe:Drosophila_2:1626501_at:598:413; Interrogation_Position=933; Antisense; GACCTTTCCATTTTGCTATGTCTGT
>probe:Drosophila_2:1626501_at:569:607; Interrogation_Position=965; Antisense; TGAGCAGCGATTGCGAATCCCTGAC

Paste this into a BLAST search page for me
GAACCACGATGTTGTACTTCATTCATCGATTTTGTTCACTGCGGGCGGAAGGAATTTTCCCCATATGTCTAAACAAAGTTCGCTTTCTCAGTGGTGACCAATCATATATGTGGTCGTTCTGCGGAGGATCCACATGGAGCTCTTGAGTGAAAGACGCTGCGTACTGATGTGGAAAGACGATCAACATTATGCCGAGCTGGGAATATGGAAACACTCTGCGTCCCAGATGTTCATCCAACTACTATCCGTTTATCCGTTGGCTTACTTTTGGGTCTGTCCATGCAGTTCTATAACACCGTAGACCTTTCCATTTTGCTATGTCTGTTGAGCAGCGATTGCGAATCCCTGAC

Full Affymetrix probeset data:

Annotations for 1626501_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720