Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626502_s_at:

>probe:Drosophila_2:1626502_s_at:391:111; Interrogation_Position=458; Antisense; AGCACTTTCTGCAGGGACGATACCT
>probe:Drosophila_2:1626502_s_at:581:303; Interrogation_Position=492; Antisense; CCGACTTGCGGATCTGTCAGCGAAA
>probe:Drosophila_2:1626502_s_at:646:495; Interrogation_Position=507; Antisense; GTCAGCGAAACTAGCCCTGGGCACA
>probe:Drosophila_2:1626502_s_at:23:595; Interrogation_Position=524; Antisense; TGGGCACAGCCCAGGTGAAGATATG
>probe:Drosophila_2:1626502_s_at:629:107; Interrogation_Position=554; Antisense; AGAACCGTCGGCGTCGTCACAAGAT
>probe:Drosophila_2:1626502_s_at:629:237; Interrogation_Position=581; Antisense; AATCGGATCAGCACAAGGACCAGTC
>probe:Drosophila_2:1626502_s_at:518:545; Interrogation_Position=614; Antisense; GGATGCCTCTCTCGCCGGGTATGAA
>probe:Drosophila_2:1626502_s_at:536:55; Interrogation_Position=634; Antisense; ATGAAACAGAGCGATGGCGATCCCC
>probe:Drosophila_2:1626502_s_at:214:275; Interrogation_Position=663; Antisense; CTTGCAGACTCTTAGCTTGGGTGGA
>probe:Drosophila_2:1626502_s_at:91:201; Interrogation_Position=729; Antisense; AACGCCCACTGCACACATGACGGAG
>probe:Drosophila_2:1626502_s_at:261:141; Interrogation_Position=748; Antisense; ACGGAGCACTACAGCGAGTCATTCA
>probe:Drosophila_2:1626502_s_at:17:327; Interrogation_Position=761; Antisense; GCGAGTCATTCAACGCCTACTACAA
>probe:Drosophila_2:1626502_s_at:446:229; Interrogation_Position=790; Antisense; AATGGAGGCCACAATCACGCCCAGG
>probe:Drosophila_2:1626502_s_at:369:69; Interrogation_Position=812; Antisense; AGGCCAATCGTCACATGCACATGCA

Paste this into a BLAST search page for me
AGCACTTTCTGCAGGGACGATACCTCCGACTTGCGGATCTGTCAGCGAAAGTCAGCGAAACTAGCCCTGGGCACATGGGCACAGCCCAGGTGAAGATATGAGAACCGTCGGCGTCGTCACAAGATAATCGGATCAGCACAAGGACCAGTCGGATGCCTCTCTCGCCGGGTATGAAATGAAACAGAGCGATGGCGATCCCCCTTGCAGACTCTTAGCTTGGGTGGAAACGCCCACTGCACACATGACGGAGACGGAGCACTACAGCGAGTCATTCAGCGAGTCATTCAACGCCTACTACAAAATGGAGGCCACAATCACGCCCAGGAGGCCAATCGTCACATGCACATGCA

Full Affymetrix probeset data:

Annotations for 1626502_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime