FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626503_at:

>probe:Drosophila_2:1626503_at:630:135; Interrogation_Position=1023; Antisense; ACGACATTTCGTGGCCGCTGAGAAG
>probe:Drosophila_2:1626503_at:165:609; Interrogation_Position=1041; Antisense; TGAGAAGATCGGTCGCCTGATTCCA
>probe:Drosophila_2:1626503_at:557:327; Interrogation_Position=1072; Antisense; GCGATGCGATTGGTCAACGATTTCT
>probe:Drosophila_2:1626503_at:20:139; Interrogation_Position=1088; Antisense; ACGATTTCTTCGACACGGGTGTGGA
>probe:Drosophila_2:1626503_at:274:131; Interrogation_Position=1114; Antisense; ACCGATAAGTCCTAGAGCTCAGCTC
>probe:Drosophila_2:1626503_at:173:187; Interrogation_Position=1154; Antisense; AACACCCCATTATCCATCTAAAAGT
>probe:Drosophila_2:1626503_at:75:183; Interrogation_Position=1357; Antisense; AAAAGTCGCACGTAGTCGGGCTAAT
>probe:Drosophila_2:1626503_at:97:413; Interrogation_Position=1371; Antisense; GTCGGGCTAATTGTGTTGGTCGTAA
>probe:Drosophila_2:1626503_at:489:417; Interrogation_Position=835; Antisense; GAGCTGCGTCAGAAGAACCCACAGA
>probe:Drosophila_2:1626503_at:163:495; Interrogation_Position=865; Antisense; GTCAAGCTGACTACCATATATCCGT
>probe:Drosophila_2:1626503_at:627:605; Interrogation_Position=893; Antisense; TGATCGATACGGGTCTGTGCAAGAA
>probe:Drosophila_2:1626503_at:443:463; Interrogation_Position=929; Antisense; GATTCCCCAATCTGTTCAAGCTGAT
>probe:Drosophila_2:1626503_at:504:711; Interrogation_Position=943; Antisense; TTCAAGCTGATACCCGCCGATGTGG
>probe:Drosophila_2:1626503_at:568:595; Interrogation_Position=963; Antisense; TGTGGCCGCCGGATCGATCATCGAG

Paste this into a BLAST search page for me
ACGACATTTCGTGGCCGCTGAGAAGTGAGAAGATCGGTCGCCTGATTCCAGCGATGCGATTGGTCAACGATTTCTACGATTTCTTCGACACGGGTGTGGAACCGATAAGTCCTAGAGCTCAGCTCAACACCCCATTATCCATCTAAAAGTAAAAGTCGCACGTAGTCGGGCTAATGTCGGGCTAATTGTGTTGGTCGTAAGAGCTGCGTCAGAAGAACCCACAGAGTCAAGCTGACTACCATATATCCGTTGATCGATACGGGTCTGTGCAAGAAGATTCCCCAATCTGTTCAAGCTGATTTCAAGCTGATACCCGCCGATGTGGTGTGGCCGCCGGATCGATCATCGAG

Full Affymetrix probeset data:

Annotations for 1626503_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720