FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626504_at:

>probe:Drosophila_2:1626504_at:3:657; Interrogation_Position=1536; Antisense; TAATGCCGAGGTCTTTGTCTGCCGA
>probe:Drosophila_2:1626504_at:440:599; Interrogation_Position=1551; Antisense; TGTCTGCCGATCACTCTACGACGAG
>probe:Drosophila_2:1626504_at:364:153; Interrogation_Position=1583; Antisense; ACATGCTGGGTAAGCTGCTGGACAA
>probe:Drosophila_2:1626504_at:704:585; Interrogation_Position=1601; Antisense; TGGACAAGCCGGGTTACGCATACGC
>probe:Drosophila_2:1626504_at:699:233; Interrogation_Position=1677; Antisense; CAATCGGTCGGTGGTCAACGTTGGT
>probe:Drosophila_2:1626504_at:68:61; Interrogation_Position=1748; Antisense; ATGTCTTTCAATTGGATGCGTTCGT
>probe:Drosophila_2:1626504_at:279:547; Interrogation_Position=1761; Antisense; GGATGCGTTCGTGAACACCAGCAAA
>probe:Drosophila_2:1626504_at:646:411; Interrogation_Position=1792; Antisense; GACCTGAGGCAGTTCCCCAAAGTGT
>probe:Drosophila_2:1626504_at:481:259; Interrogation_Position=1866; Antisense; CACGCAATCCGTGCAGAACATTTTG
>probe:Drosophila_2:1626504_at:507:31; Interrogation_Position=1892; Antisense; ATAACATGCTGCAGACGTCCTCGTT
>probe:Drosophila_2:1626504_at:49:475; Interrogation_Position=1914; Antisense; GTTCAATTTGACCACGTACCGCAGC
>probe:Drosophila_2:1626504_at:650:459; Interrogation_Position=1966; Antisense; GATTTGGCCACGTTCATTGATCAGA
>probe:Drosophila_2:1626504_at:184:725; Interrogation_Position=1982; Antisense; TTGATCAGATGCAGCGGGTGGCCTT
>probe:Drosophila_2:1626504_at:185:81; Interrogation_Position=2009; Antisense; AGGTGAGTGCAACACCCTCTGATTA

Paste this into a BLAST search page for me
TAATGCCGAGGTCTTTGTCTGCCGATGTCTGCCGATCACTCTACGACGAGACATGCTGGGTAAGCTGCTGGACAATGGACAAGCCGGGTTACGCATACGCCAATCGGTCGGTGGTCAACGTTGGTATGTCTTTCAATTGGATGCGTTCGTGGATGCGTTCGTGAACACCAGCAAAGACCTGAGGCAGTTCCCCAAAGTGTCACGCAATCCGTGCAGAACATTTTGATAACATGCTGCAGACGTCCTCGTTGTTCAATTTGACCACGTACCGCAGCGATTTGGCCACGTTCATTGATCAGATTGATCAGATGCAGCGGGTGGCCTTAGGTGAGTGCAACACCCTCTGATTA

Full Affymetrix probeset data:

Annotations for 1626504_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720