FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626506_at:

>probe:Drosophila_2:1626506_at:555:71; Interrogation_Position=1006; Antisense; AGGCGGAGAACGTACACATCTACAA
>probe:Drosophila_2:1626506_at:674:151; Interrogation_Position=1021; Antisense; ACATCTACAACTTTCTGCAGGGCGT
>probe:Drosophila_2:1626506_at:374:383; Interrogation_Position=1073; Antisense; GAACGTGGTAGACATTGCCCAACTG
>probe:Drosophila_2:1626506_at:518:253; Interrogation_Position=1092; Antisense; CAACTGCAGGACATTTTCACCGAAA
>probe:Drosophila_2:1626506_at:431:69; Interrogation_Position=1210; Antisense; AGGCCACTCAACGAAATGCAGGACT
>probe:Drosophila_2:1626506_at:4:75; Interrogation_Position=1229; Antisense; AGGACTACGCGTGTGGTCGCTGTTC
>probe:Drosophila_2:1626506_at:534:617; Interrogation_Position=1279; Antisense; TGCTCTTCTTGGACTGGTACTACGA
>probe:Drosophila_2:1626506_at:233:511; Interrogation_Position=1308; Antisense; GTGAAGTCCCCAAATTTATGTGTAA
>probe:Drosophila_2:1626506_at:348:703; Interrogation_Position=1323; Antisense; TTATGTGTAACCCACCCAATTTAGG
>probe:Drosophila_2:1626506_at:104:477; Interrogation_Position=1367; Antisense; GTTTTGTTATCGTTTGATCGCACTA
>probe:Drosophila_2:1626506_at:361:571; Interrogation_Position=1446; Antisense; GGCTATTCAACTGCCTTGTTTCAAT
>probe:Drosophila_2:1626506_at:152:451; Interrogation_Position=900; Antisense; GATCTGAACAACTCATCCTCCAAGA
>probe:Drosophila_2:1626506_at:488:437; Interrogation_Position=957; Antisense; GAGGCCGACGATGACGATCCCCTAA
>probe:Drosophila_2:1626506_at:385:63; Interrogation_Position=991; Antisense; ATGTGCAGCTCTTCGAGGCGGAGAA

Paste this into a BLAST search page for me
AGGCGGAGAACGTACACATCTACAAACATCTACAACTTTCTGCAGGGCGTGAACGTGGTAGACATTGCCCAACTGCAACTGCAGGACATTTTCACCGAAAAGGCCACTCAACGAAATGCAGGACTAGGACTACGCGTGTGGTCGCTGTTCTGCTCTTCTTGGACTGGTACTACGAGTGAAGTCCCCAAATTTATGTGTAATTATGTGTAACCCACCCAATTTAGGGTTTTGTTATCGTTTGATCGCACTAGGCTATTCAACTGCCTTGTTTCAATGATCTGAACAACTCATCCTCCAAGAGAGGCCGACGATGACGATCCCCTAAATGTGCAGCTCTTCGAGGCGGAGAA

Full Affymetrix probeset data:

Annotations for 1626506_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720