FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626507_at:

>probe:Drosophila_2:1626507_at:255:215; Interrogation_Position=1567; Antisense; AAGATCGCCAACAGTGTGCCGGAGA
>probe:Drosophila_2:1626507_at:71:551; Interrogation_Position=1602; Antisense; GGAGTGCCTGGTGCGCTACAAGTAT
>probe:Drosophila_2:1626507_at:461:161; Interrogation_Position=1619; Antisense; ACAAGTATCTCTGCGAGCTGGTCAA
>probe:Drosophila_2:1626507_at:477:113; Interrogation_Position=1784; Antisense; AGCAGCGTCGCCGTAAGCGGGACTT
>probe:Drosophila_2:1626507_at:669:657; Interrogation_Position=1797; Antisense; TAAGCGGGACTTATCCAGCGGCGAG
>probe:Drosophila_2:1626507_at:332:557; Interrogation_Position=1821; Antisense; GGACTCGGACGATGCATATCAGTAC
>probe:Drosophila_2:1626507_at:416:399; Interrogation_Position=1846; Antisense; GAGATCAGTTAGTCGGAAACCCGGC
>probe:Drosophila_2:1626507_at:101:283; Interrogation_Position=1901; Antisense; CTCGCGTGGCTCACAACTAGATGTA
>probe:Drosophila_2:1626507_at:200:213; Interrogation_Position=1952; Antisense; AAGACTCTCTGGCATAGCATTTTGG
>probe:Drosophila_2:1626507_at:237:95; Interrogation_Position=1967; Antisense; AGCATTTTGGACCTTGCCAATCCTA
>probe:Drosophila_2:1626507_at:36:611; Interrogation_Position=2021; Antisense; TGACCTTCTGTTTCCATCACCGTGT
>probe:Drosophila_2:1626507_at:280:35; Interrogation_Position=2036; Antisense; ATCACCGTGTGTAGCGCTTATCTTA
>probe:Drosophila_2:1626507_at:590:675; Interrogation_Position=2047; Antisense; TAGCGCTTATCTTATGTTTTGTACA
>probe:Drosophila_2:1626507_at:236:229; Interrogation_Position=2095; Antisense; AATGTCGATTAATTCCTTTGCTAAG

Paste this into a BLAST search page for me
AAGATCGCCAACAGTGTGCCGGAGAGGAGTGCCTGGTGCGCTACAAGTATACAAGTATCTCTGCGAGCTGGTCAAAGCAGCGTCGCCGTAAGCGGGACTTTAAGCGGGACTTATCCAGCGGCGAGGGACTCGGACGATGCATATCAGTACGAGATCAGTTAGTCGGAAACCCGGCCTCGCGTGGCTCACAACTAGATGTAAAGACTCTCTGGCATAGCATTTTGGAGCATTTTGGACCTTGCCAATCCTATGACCTTCTGTTTCCATCACCGTGTATCACCGTGTGTAGCGCTTATCTTATAGCGCTTATCTTATGTTTTGTACAAATGTCGATTAATTCCTTTGCTAAG

Full Affymetrix probeset data:

Annotations for 1626507_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720