FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626508_at:

>probe:Drosophila_2:1626508_at:581:53; Interrogation_Position=1058; Antisense; ATGCAACAGTTCACCGAGCGACGCG
>probe:Drosophila_2:1626508_at:473:411; Interrogation_Position=1077; Antisense; GACGCGTCTCTCTTTATTTGCTAAA
>probe:Drosophila_2:1626508_at:602:457; Interrogation_Position=642; Antisense; GATTTGGACACGGACCAACCGGTGT
>probe:Drosophila_2:1626508_at:69:63; Interrogation_Position=677; Antisense; ATGTCGCTACGACGAGTCTGACTTG
>probe:Drosophila_2:1626508_at:22:583; Interrogation_Position=700; Antisense; TGGCCGCCCAGTACTGCAATGATTT
>probe:Drosophila_2:1626508_at:223:231; Interrogation_Position=717; Antisense; AATGATTTCTTTTCCTTGCCTGCCA
>probe:Drosophila_2:1626508_at:622:381; Interrogation_Position=754; Antisense; GAACGCAGGCCTCTTTGATGGATTA
>probe:Drosophila_2:1626508_at:638:541; Interrogation_Position=773; Antisense; GGATTACGAGATGCAGGCCACCGGC
>probe:Drosophila_2:1626508_at:254:41; Interrogation_Position=815; Antisense; ATCGGAGACGAGTTTTCCAGCGCAG
>probe:Drosophila_2:1626508_at:653:353; Interrogation_Position=875; Antisense; GCAGCCACATCAATATCAGCGCATT
>probe:Drosophila_2:1626508_at:530:649; Interrogation_Position=890; Antisense; TCAGCGCATTCATCAGCATTATCAA
>probe:Drosophila_2:1626508_at:290:685; Interrogation_Position=909; Antisense; TATCAAGGTCATTTGCATCGCGCCA
>probe:Drosophila_2:1626508_at:478:45; Interrogation_Position=925; Antisense; ATCGCGCCAACCGTGATGTGAGTCG
>probe:Drosophila_2:1626508_at:676:511; Interrogation_Position=942; Antisense; GTGAGTCGTTGCATGATGTCGCACA

Paste this into a BLAST search page for me
ATGCAACAGTTCACCGAGCGACGCGGACGCGTCTCTCTTTATTTGCTAAAGATTTGGACACGGACCAACCGGTGTATGTCGCTACGACGAGTCTGACTTGTGGCCGCCCAGTACTGCAATGATTTAATGATTTCTTTTCCTTGCCTGCCAGAACGCAGGCCTCTTTGATGGATTAGGATTACGAGATGCAGGCCACCGGCATCGGAGACGAGTTTTCCAGCGCAGGCAGCCACATCAATATCAGCGCATTTCAGCGCATTCATCAGCATTATCAATATCAAGGTCATTTGCATCGCGCCAATCGCGCCAACCGTGATGTGAGTCGGTGAGTCGTTGCATGATGTCGCACA

Full Affymetrix probeset data:

Annotations for 1626508_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720