Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626509_at:

>probe:Drosophila_2:1626509_at:653:133; Interrogation_Position=4841; Antisense; ACGCCCACAACACATTCATATACGA
>probe:Drosophila_2:1626509_at:331:469; Interrogation_Position=4929; Antisense; GTTGCAGAAACACTTTCAAATTCAA
>probe:Drosophila_2:1626509_at:167:193; Interrogation_Position=4969; Antisense; AACTATAATTAAATCGGCAGACGAG
>probe:Drosophila_2:1626509_at:203:349; Interrogation_Position=4985; Antisense; GCAGACGAGAGTATGCCCCTTACTG
>probe:Drosophila_2:1626509_at:663:483; Interrogation_Position=4995; Antisense; GTATGCCCCTTACTGTAATGCGTAG
>probe:Drosophila_2:1626509_at:129:233; Interrogation_Position=5011; Antisense; AATGCGTAGACGTATGTAGTAGTTC
>probe:Drosophila_2:1626509_at:486:59; Interrogation_Position=5024; Antisense; ATGTAGTAGTTCTAGCCAGGCGTAA
>probe:Drosophila_2:1626509_at:401:709; Interrogation_Position=5033; Antisense; TTCTAGCCAGGCGTAAAGAACGTAA
>probe:Drosophila_2:1626509_at:16:681; Interrogation_Position=5118; Antisense; TATGTACACACATTCGTTCGCATCC
>probe:Drosophila_2:1626509_at:642:257; Interrogation_Position=5126; Antisense; CACATTCGTTCGCATCCAGTTGATC
>probe:Drosophila_2:1626509_at:202:347; Interrogation_Position=5137; Antisense; GCATCCAGTTGATCGTGTTTGTCGA
>probe:Drosophila_2:1626509_at:242:515; Interrogation_Position=5151; Antisense; GTGTTTGTCGATTCATTCATCCTAA
>probe:Drosophila_2:1626509_at:156:461; Interrogation_Position=5160; Antisense; GATTCATTCATCCTAAGCTACACGA
>probe:Drosophila_2:1626509_at:414:551; Interrogation_Position=5238; Antisense; GGAGCAAACCCATTTAGAGCACTTA

Paste this into a BLAST search page for me
ACGCCCACAACACATTCATATACGAGTTGCAGAAACACTTTCAAATTCAAAACTATAATTAAATCGGCAGACGAGGCAGACGAGAGTATGCCCCTTACTGGTATGCCCCTTACTGTAATGCGTAGAATGCGTAGACGTATGTAGTAGTTCATGTAGTAGTTCTAGCCAGGCGTAATTCTAGCCAGGCGTAAAGAACGTAATATGTACACACATTCGTTCGCATCCCACATTCGTTCGCATCCAGTTGATCGCATCCAGTTGATCGTGTTTGTCGAGTGTTTGTCGATTCATTCATCCTAAGATTCATTCATCCTAAGCTACACGAGGAGCAAACCCATTTAGAGCACTTA

Full Affymetrix probeset data:

Annotations for 1626509_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime