Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626511_at:

>probe:Drosophila_2:1626511_at:135:535; Interrogation_Position=2733; Antisense; GGTGATGACCGAGTTTGCCCTGGAC
>probe:Drosophila_2:1626511_at:409:717; Interrogation_Position=2762; Antisense; TTCGCATCATGCACGACATTCGGTA
>probe:Drosophila_2:1626511_at:531:535; Interrogation_Position=2783; Antisense; GGTACAACTACGTGTTCTCGGAGTA
>probe:Drosophila_2:1626511_at:566:215; Interrogation_Position=2833; Antisense; AAGATAGGCATCTCCCATGGATCCG
>probe:Drosophila_2:1626511_at:725:315; Interrogation_Position=2863; Antisense; GCCGGCGTTGTTGGACTCTCGAAAC
>probe:Drosophila_2:1626511_at:577:557; Interrogation_Position=2875; Antisense; GGACTCTCGAAACCACACTATGATA
>probe:Drosophila_2:1626511_at:92:531; Interrogation_Position=2904; Antisense; GGGTCATACCGTCAATATGGCCTCC
>probe:Drosophila_2:1626511_at:700:189; Interrogation_Position=2956; Antisense; AACATCCAAGTAACTCGGCACACGG
>probe:Drosophila_2:1626511_at:647:259; Interrogation_Position=2976; Antisense; CACGGCAAAGGTGCTGCGACAATTT
>probe:Drosophila_2:1626511_at:426:161; Interrogation_Position=2994; Antisense; ACAATTTAACATCCGCTGCAACTAC
>probe:Drosophila_2:1626511_at:727:673; Interrogation_Position=3074; Antisense; TAGACCCGGATCTCACATTCCAAGA
>probe:Drosophila_2:1626511_at:338:183; Interrogation_Position=3133; Antisense; AAAAGCTGGGTCATCGACACTCTTT
>probe:Drosophila_2:1626511_at:595:549; Interrogation_Position=3261; Antisense; GGAGGTCTCGATACATGAGCGCCAA
>probe:Drosophila_2:1626511_at:89:183; Interrogation_Position=3284; Antisense; AAAAGGGAGGCATCTTTCTGGCCGG

Paste this into a BLAST search page for me
GGTGATGACCGAGTTTGCCCTGGACTTCGCATCATGCACGACATTCGGTAGGTACAACTACGTGTTCTCGGAGTAAAGATAGGCATCTCCCATGGATCCGGCCGGCGTTGTTGGACTCTCGAAACGGACTCTCGAAACCACACTATGATAGGGTCATACCGTCAATATGGCCTCCAACATCCAAGTAACTCGGCACACGGCACGGCAAAGGTGCTGCGACAATTTACAATTTAACATCCGCTGCAACTACTAGACCCGGATCTCACATTCCAAGAAAAAGCTGGGTCATCGACACTCTTTGGAGGTCTCGATACATGAGCGCCAAAAAAGGGAGGCATCTTTCTGGCCGG

Full Affymetrix probeset data:

Annotations for 1626511_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime