Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626513_at:

>probe:Drosophila_2:1626513_at:275:175; Interrogation_Position=1164; Antisense; AAAGCCGGACGAGACCGTGGTCACG
>probe:Drosophila_2:1626513_at:67:135; Interrogation_Position=1186; Antisense; ACGCCCGAAGTGTACGCCAAGATTG
>probe:Drosophila_2:1626513_at:279:465; Interrogation_Position=1206; Antisense; GATTGTGAAACTGGCCGATCAGCTG
>probe:Drosophila_2:1626513_at:94:571; Interrogation_Position=1262; Antisense; GGCATTTGATCTTCGATTCGGGCAG
>probe:Drosophila_2:1626513_at:420:449; Interrogation_Position=1294; Antisense; GATAATAATGGCTTGCCCCACCACA
>probe:Drosophila_2:1626513_at:333:179; Interrogation_Position=1353; Antisense; AAACTTCAAGCGTTTCTTACAGCGC
>probe:Drosophila_2:1626513_at:596:93; Interrogation_Position=1383; Antisense; AGTTCCTCCAGTGGCCATTACAATG
>probe:Drosophila_2:1626513_at:619:581; Interrogation_Position=1406; Antisense; TGGCCCATTCCGCTCAAGATGACTA
>probe:Drosophila_2:1626513_at:134:469; Interrogation_Position=1468; Antisense; GTTCTACGCCTGCTTAAGGAGGTTT
>probe:Drosophila_2:1626513_at:609:535; Interrogation_Position=1488; Antisense; GGTTTTTGGCGAAAGACTGCACGAC
>probe:Drosophila_2:1626513_at:606:211; Interrogation_Position=1500; Antisense; AAGACTGCACGACAAAGCCATCCTG
>probe:Drosophila_2:1626513_at:563:201; Interrogation_Position=1514; Antisense; AAGCCATCCTGCACTATATGGACGA
>probe:Drosophila_2:1626513_at:155:321; Interrogation_Position=1590; Antisense; GCCCGCCACTGCGAATTAGATTCTG
>probe:Drosophila_2:1626513_at:241:215; Interrogation_Position=1656; Antisense; AAGATACCCGTAGTGATTTCGAATT

Paste this into a BLAST search page for me
AAAGCCGGACGAGACCGTGGTCACGACGCCCGAAGTGTACGCCAAGATTGGATTGTGAAACTGGCCGATCAGCTGGGCATTTGATCTTCGATTCGGGCAGGATAATAATGGCTTGCCCCACCACAAAACTTCAAGCGTTTCTTACAGCGCAGTTCCTCCAGTGGCCATTACAATGTGGCCCATTCCGCTCAAGATGACTAGTTCTACGCCTGCTTAAGGAGGTTTGGTTTTTGGCGAAAGACTGCACGACAAGACTGCACGACAAAGCCATCCTGAAGCCATCCTGCACTATATGGACGAGCCCGCCACTGCGAATTAGATTCTGAAGATACCCGTAGTGATTTCGAATT

Full Affymetrix probeset data:

Annotations for 1626513_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime