FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626514_at:

>probe:Drosophila_2:1626514_at:169:167; Interrogation_Position=403; Antisense; AAATGCCGCGCCCAAGTGGTACTTA
>probe:Drosophila_2:1626514_at:70:669; Interrogation_Position=422; Antisense; TACTTACTGACAACTGCATTCTGCC
>probe:Drosophila_2:1626514_at:38:219; Interrogation_Position=448; Antisense; AAGTCACTGGCCCATATCCGAAAGT
>probe:Drosophila_2:1626514_at:666:615; Interrogation_Position=491; Antisense; TGCAGCCGGGCGTTGATATCGATGT
>probe:Drosophila_2:1626514_at:112:587; Interrogation_Position=569; Antisense; TGGACCTTATCATTGCAGCAGACTG
>probe:Drosophila_2:1626514_at:459:671; Interrogation_Position=598; Antisense; TACGATCCCAGCGTGTTCGAGGATA
>probe:Drosophila_2:1626514_at:206:155; Interrogation_Position=631; Antisense; ACAGTTGCTTTTCTGCTGGAGCGAA
>probe:Drosophila_2:1626514_at:535:707; Interrogation_Position=677; Antisense; TTACATACCAGGAGCGGAGCGCCGA
>probe:Drosophila_2:1626514_at:168:143; Interrogation_Position=701; Antisense; ACTGGTCCATAGAGGCGCTGCTCAA
>probe:Drosophila_2:1626514_at:494:563; Interrogation_Position=731; Antisense; GGAAGCTGCAGGCTTTACCCATCAG
>probe:Drosophila_2:1626514_at:605:287; Interrogation_Position=807; Antisense; CGGACACACTATTCATCTTCTGGAG
>probe:Drosophila_2:1626514_at:414:645; Interrogation_Position=822; Antisense; TCTTCTGGAGATCACGCGCATCGAA
>probe:Drosophila_2:1626514_at:171:335; Interrogation_Position=899; Antisense; GCTGAATGTCAAATCTCTCTTAGTT
>probe:Drosophila_2:1626514_at:581:687; Interrogation_Position=962; Antisense; TATTTGCCTGTGGTAATCGCTTGAA

Paste this into a BLAST search page for me
AAATGCCGCGCCCAAGTGGTACTTATACTTACTGACAACTGCATTCTGCCAAGTCACTGGCCCATATCCGAAAGTTGCAGCCGGGCGTTGATATCGATGTTGGACCTTATCATTGCAGCAGACTGTACGATCCCAGCGTGTTCGAGGATAACAGTTGCTTTTCTGCTGGAGCGAATTACATACCAGGAGCGGAGCGCCGAACTGGTCCATAGAGGCGCTGCTCAAGGAAGCTGCAGGCTTTACCCATCAGCGGACACACTATTCATCTTCTGGAGTCTTCTGGAGATCACGCGCATCGAAGCTGAATGTCAAATCTCTCTTAGTTTATTTGCCTGTGGTAATCGCTTGAA

Full Affymetrix probeset data:

Annotations for 1626514_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720