Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626518_at:

>probe:Drosophila_2:1626518_at:45:419; Interrogation_Position=3022; Antisense; GAGCTGAAGAACGAGCTGCTGATTA
>probe:Drosophila_2:1626518_at:619:371; Interrogation_Position=3027; Antisense; GAAGAACGAGCTGCTGATTAAGGGC
>probe:Drosophila_2:1626518_at:713:709; Interrogation_Position=3044; Antisense; TTAAGGGCGGCGACGCCTACACCCT
>probe:Drosophila_2:1626518_at:689:585; Interrogation_Position=3068; Antisense; TGGACACTGCCTCCATGTACCACCT
>probe:Drosophila_2:1626518_at:488:715; Interrogation_Position=3097; Antisense; TTCTCGCCCACCTCGATGATCAATG
>probe:Drosophila_2:1626518_at:471:317; Interrogation_Position=3102; Antisense; GCCCACCTCGATGATCAATGCGGTG
>probe:Drosophila_2:1626518_at:490:129; Interrogation_Position=3106; Antisense; ACCTCGATGATCAATGCGGTGAACG
>probe:Drosophila_2:1626518_at:349:453; Interrogation_Position=3114; Antisense; GATCAATGCGGTGAACGATGTGAAC
>probe:Drosophila_2:1626518_at:520:613; Interrogation_Position=3125; Antisense; TGAACGATGTGAACACCTCGTCGCT
>probe:Drosophila_2:1626518_at:204:443; Interrogation_Position=3130; Antisense; GATGTGAACACCTCGTCGCTGCTGG
>probe:Drosophila_2:1626518_at:314:511; Interrogation_Position=3133; Antisense; GTGAACACCTCGTCGCTGCTGGAAA
>probe:Drosophila_2:1626518_at:194:131; Interrogation_Position=3139; Antisense; ACCTCGTCGCTGCTGGAAACCAAAG
>probe:Drosophila_2:1626518_at:344:501; Interrogation_Position=3144; Antisense; GTCGCTGCTGGAAACCAAAGAAATT
>probe:Drosophila_2:1626518_at:492:255; Interrogation_Position=3159; Antisense; CAAAGAAATTAGCTACGATATATCA

Paste this into a BLAST search page for me
GAGCTGAAGAACGAGCTGCTGATTAGAAGAACGAGCTGCTGATTAAGGGCTTAAGGGCGGCGACGCCTACACCCTTGGACACTGCCTCCATGTACCACCTTTCTCGCCCACCTCGATGATCAATGGCCCACCTCGATGATCAATGCGGTGACCTCGATGATCAATGCGGTGAACGGATCAATGCGGTGAACGATGTGAACTGAACGATGTGAACACCTCGTCGCTGATGTGAACACCTCGTCGCTGCTGGGTGAACACCTCGTCGCTGCTGGAAAACCTCGTCGCTGCTGGAAACCAAAGGTCGCTGCTGGAAACCAAAGAAATTCAAAGAAATTAGCTACGATATATCA

Full Affymetrix probeset data:

Annotations for 1626518_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime