Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626520_at:

>probe:Drosophila_2:1626520_at:690:301; Interrogation_Position=1250; Antisense; GCCTTTAATACAGAGCCCAGGAATT
>probe:Drosophila_2:1626520_at:465:191; Interrogation_Position=1295; Antisense; AACTATCTGCCGCATTTTAAGGAAA
>probe:Drosophila_2:1626520_at:434:165; Interrogation_Position=1317; Antisense; AAATCGATGATGTCGTGACCGCCAT
>probe:Drosophila_2:1626520_at:466:133; Interrogation_Position=1334; Antisense; ACCGCCATAAATGACTTGGGCCTAT
>probe:Drosophila_2:1626520_at:288:275; Interrogation_Position=1348; Antisense; CTTGGGCCTATCAGATTGCATGCTC
>probe:Drosophila_2:1626520_at:437:439; Interrogation_Position=1402; Antisense; GATGGGCTTAAACGTTGCCATACGA
>probe:Drosophila_2:1626520_at:635:475; Interrogation_Position=1430; Antisense; GTTATGATGTCCAATACGTGCCCTG
>probe:Drosophila_2:1626520_at:561:27; Interrogation_Position=1443; Antisense; ATACGTGCCCTGTCAGCGGATGGAT
>probe:Drosophila_2:1626520_at:577:441; Interrogation_Position=1461; Antisense; GATGGATGCCTGTTCGAGGACCCAA
>probe:Drosophila_2:1626520_at:218:295; Interrogation_Position=1487; Antisense; CGAATCAATATACAGCCACAGGCAA
>probe:Drosophila_2:1626520_at:149:311; Interrogation_Position=1502; Antisense; CCACAGGCAACTTTGGCCGAACAAA
>probe:Drosophila_2:1626520_at:361:673; Interrogation_Position=1568; Antisense; TACGCCACGGAGTACAGCTCATTAG
>probe:Drosophila_2:1626520_at:719:565; Interrogation_Position=1607; Antisense; GGCAAGCCTGTGGATACTACTTCAA
>probe:Drosophila_2:1626520_at:637:245; Interrogation_Position=1777; Antisense; AATTAAATGTACTGCGCATCCCACC

Paste this into a BLAST search page for me
GCCTTTAATACAGAGCCCAGGAATTAACTATCTGCCGCATTTTAAGGAAAAAATCGATGATGTCGTGACCGCCATACCGCCATAAATGACTTGGGCCTATCTTGGGCCTATCAGATTGCATGCTCGATGGGCTTAAACGTTGCCATACGAGTTATGATGTCCAATACGTGCCCTGATACGTGCCCTGTCAGCGGATGGATGATGGATGCCTGTTCGAGGACCCAACGAATCAATATACAGCCACAGGCAACCACAGGCAACTTTGGCCGAACAAATACGCCACGGAGTACAGCTCATTAGGGCAAGCCTGTGGATACTACTTCAAAATTAAATGTACTGCGCATCCCACC

Full Affymetrix probeset data:

Annotations for 1626520_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime