Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626521_x_at:

>probe:Drosophila_2:1626521_x_at:135:635; Interrogation_Position=429; Antisense; TCCCAGCTCCGGCTCCAATTGAGAT
>probe:Drosophila_2:1626521_x_at:239:337; Interrogation_Position=434; Antisense; GCTCCGGCTCCAATTGAGATCCCTG
>probe:Drosophila_2:1626521_x_at:299:37; Interrogation_Position=493; Antisense; ACCAGCACCAGCTCCGGTTTACCAG
>probe:Drosophila_2:1626521_x_at:77:629; Interrogation_Position=607; Antisense; TCCAGCACCAGTTGTGATCCCTGCT
>probe:Drosophila_2:1626521_x_at:133:117; Interrogation_Position=664; Antisense; AGCTCCCGTTAAGTCCTATGTGCCA
>probe:Drosophila_2:1626521_x_at:461:471; Interrogation_Position=671; Antisense; GTTAAGTCCTATGTGCCACCTGCAC
>probe:Drosophila_2:1626521_x_at:213:61; Interrogation_Position=681; Antisense; ATGTGCCACCTGCACCAATCAGCAT
>probe:Drosophila_2:1626521_x_at:124:127; Interrogation_Position=795; Antisense; AGCCAACCAACACTCAGGTTCTGGA
>probe:Drosophila_2:1626521_x_at:128:311; Interrogation_Position=801; Antisense; CCAACACTCAGGTTCTGGAGGAGAT
>probe:Drosophila_2:1626521_x_at:208:125; Interrogation_Position=828; Antisense; AGCCCGCTTCCAATGATGGATACCG
>probe:Drosophila_2:1626521_x_at:558:211; Interrogation_Position=857; Antisense; AAGACCGTGCGTCGTCGCGTCTACC
>probe:Drosophila_2:1626521_x_at:242:633; Interrogation_Position=871; Antisense; TCGCGTCTACCGTCACCGTTTCTAA
>probe:Drosophila_2:1626521_x_at:570:351; Interrogation_Position=944; Antisense; GACTCGCAATAAAAAATTTCCGCCT
>probe:Drosophila_2:1626521_x_at:199:361; Interrogation_Position=949; Antisense; GCAATAAAAAATTTCCGCCTTCAAT

Paste this into a BLAST search page for me
TCCCAGCTCCGGCTCCAATTGAGATGCTCCGGCTCCAATTGAGATCCCTGACCAGCACCAGCTCCGGTTTACCAGTCCAGCACCAGTTGTGATCCCTGCTAGCTCCCGTTAAGTCCTATGTGCCAGTTAAGTCCTATGTGCCACCTGCACATGTGCCACCTGCACCAATCAGCATAGCCAACCAACACTCAGGTTCTGGACCAACACTCAGGTTCTGGAGGAGATAGCCCGCTTCCAATGATGGATACCGAAGACCGTGCGTCGTCGCGTCTACCTCGCGTCTACCGTCACCGTTTCTAAGACTCGCAATAAAAAATTTCCGCCTGCAATAAAAAATTTCCGCCTTCAAT

Full Affymetrix probeset data:

Annotations for 1626521_x_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime