FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626526_at:

>probe:Drosophila_2:1626526_at:45:499; Interrogation_Position=107; Antisense; GTCTGCCACTGACTGTCCAGGATCG
>probe:Drosophila_2:1626526_at:658:629; Interrogation_Position=122; Antisense; TCCAGGATCGGACCTATGCCAACAA
>probe:Drosophila_2:1626526_at:12:627; Interrogation_Position=138; Antisense; TGCCAACAATGTGATCAGGAGGTAC
>probe:Drosophila_2:1626526_at:24:453; Interrogation_Position=150; Antisense; GATCAGGAGGTACCGGGCACACAAC
>probe:Drosophila_2:1626526_at:314:189; Interrogation_Position=179; Antisense; AACAGGTCGATGGTGTTCCTGCTCA
>probe:Drosophila_2:1626526_at:400:349; Interrogation_Position=19; Antisense; GCAGTCTTCGGCAACTCAGAGGTCG
>probe:Drosophila_2:1626526_at:289:467; Interrogation_Position=211; Antisense; GTTGGTGTGGTGTTCGCGCTACTTC
>probe:Drosophila_2:1626526_at:123:669; Interrogation_Position=230; Antisense; TACTTCTTCCTTTCGCTGTGTCAAT
>probe:Drosophila_2:1626526_at:355:629; Interrogation_Position=237; Antisense; TCCTTTCGCTGTGTCAATTGTGGAA
>probe:Drosophila_2:1626526_at:51:567; Interrogation_Position=28; Antisense; GGCAACTCAGAGGTCGATAGATACA
>probe:Drosophila_2:1626526_at:599:457; Interrogation_Position=43; Antisense; GATAGATACACCAAGTCCCGAAATT
>probe:Drosophila_2:1626526_at:505:217; Interrogation_Position=55; Antisense; AAGTCCCGAAATTTGCCCGCATTGA
>probe:Drosophila_2:1626526_at:476:625; Interrogation_Position=68; Antisense; TGCCCGCATTGATTGAGTTCTACGA
>probe:Drosophila_2:1626526_at:14:423; Interrogation_Position=91; Antisense; GAGAAGTACTCCAGTCGTCTGCCAC

Paste this into a BLAST search page for me
GTCTGCCACTGACTGTCCAGGATCGTCCAGGATCGGACCTATGCCAACAATGCCAACAATGTGATCAGGAGGTACGATCAGGAGGTACCGGGCACACAACAACAGGTCGATGGTGTTCCTGCTCAGCAGTCTTCGGCAACTCAGAGGTCGGTTGGTGTGGTGTTCGCGCTACTTCTACTTCTTCCTTTCGCTGTGTCAATTCCTTTCGCTGTGTCAATTGTGGAAGGCAACTCAGAGGTCGATAGATACAGATAGATACACCAAGTCCCGAAATTAAGTCCCGAAATTTGCCCGCATTGATGCCCGCATTGATTGAGTTCTACGAGAGAAGTACTCCAGTCGTCTGCCAC

Full Affymetrix probeset data:

Annotations for 1626526_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720