FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626527_at:

>probe:Drosophila_2:1626527_at:218:121; Interrogation_Position=1884; Antisense; AGCTGGCGCCACGATTGAGATGGAA
>probe:Drosophila_2:1626527_at:460:561; Interrogation_Position=1913; Antisense; GGAAGAGCGATCCTGATCCCAACGA
>probe:Drosophila_2:1626527_at:598:449; Interrogation_Position=1927; Antisense; GATCCCAACGATCCTGTATTGTATT
>probe:Drosophila_2:1626527_at:719:683; Interrogation_Position=1953; Antisense; TATCCTGTAGTTATGTATATGCCTA
>probe:Drosophila_2:1626527_at:31:451; Interrogation_Position=2017; Antisense; GATCGATACTATTTATTTACCACCA
>probe:Drosophila_2:1626527_at:301:389; Interrogation_Position=2131; Antisense; GAAAACACTGTTAAATGTCCTTGAC
>probe:Drosophila_2:1626527_at:78:61; Interrogation_Position=2145; Antisense; ATGTCCTTGACTTATTGTTTTTGCA
>probe:Drosophila_2:1626527_at:496:655; Interrogation_Position=2183; Antisense; TAAGTAGGCAATCCTCGGCGCAGAT
>probe:Drosophila_2:1626527_at:502:575; Interrogation_Position=2199; Antisense; GGCGCAGATCCTAAATCATCCTGAG
>probe:Drosophila_2:1626527_at:16:165; Interrogation_Position=2225; Antisense; AAATCAATCGGCAAACTCCCGGAGA
>probe:Drosophila_2:1626527_at:719:129; Interrogation_Position=2239; Antisense; ACTCCCGGAGAACACAGACGACTGT
>probe:Drosophila_2:1626527_at:251:105; Interrogation_Position=2254; Antisense; AGACGACTGTTACTGTATATTATCA
>probe:Drosophila_2:1626527_at:422:33; Interrogation_Position=2293; Antisense; ATAATTTATTGAGGTGCGGCGGCGA
>probe:Drosophila_2:1626527_at:613:287; Interrogation_Position=2312; Antisense; CGGCGAGTTCAAGCCCTTTGATATA

Paste this into a BLAST search page for me
AGCTGGCGCCACGATTGAGATGGAAGGAAGAGCGATCCTGATCCCAACGAGATCCCAACGATCCTGTATTGTATTTATCCTGTAGTTATGTATATGCCTAGATCGATACTATTTATTTACCACCAGAAAACACTGTTAAATGTCCTTGACATGTCCTTGACTTATTGTTTTTGCATAAGTAGGCAATCCTCGGCGCAGATGGCGCAGATCCTAAATCATCCTGAGAAATCAATCGGCAAACTCCCGGAGAACTCCCGGAGAACACAGACGACTGTAGACGACTGTTACTGTATATTATCAATAATTTATTGAGGTGCGGCGGCGACGGCGAGTTCAAGCCCTTTGATATA

Full Affymetrix probeset data:

Annotations for 1626527_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720