FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626529_at:

>probe:Drosophila_2:1626529_at:139:131; Interrogation_Position=419; Antisense; ACCTCAAGCGGTGTGCAACATCTGG
>probe:Drosophila_2:1626529_at:430:433; Interrogation_Position=475; Antisense; GAGTGCGATCTCATTCCTAGCAAGA
>probe:Drosophila_2:1626529_at:460:269; Interrogation_Position=588; Antisense; CATCAAACCTTTACCGGGATTCCTG
>probe:Drosophila_2:1626529_at:217:261; Interrogation_Position=613; Antisense; CAGGCCTTTGGTTCCACCGAAATAG
>probe:Drosophila_2:1626529_at:149:395; Interrogation_Position=631; Antisense; GAAATAGGTCGCTTCTCCGAGCGTT
>probe:Drosophila_2:1626529_at:649:613; Interrogation_Position=659; Antisense; TGCAAACGCCGGAATCCCTAGTAGA
>probe:Drosophila_2:1626529_at:609:23; Interrogation_Position=699; Antisense; ATATGCAGGCAGTGCACCCAACAAC
>probe:Drosophila_2:1626529_at:675:711; Interrogation_Position=735; Antisense; TTCAGCTGGAGGCTACATCGAGTCC
>probe:Drosophila_2:1626529_at:7:135; Interrogation_Position=772; Antisense; ACGCACAACTACTATCCTTATGAGG
>probe:Drosophila_2:1626529_at:451:369; Interrogation_Position=801; Antisense; GAACCAAGGCGGCTATCCAAGGAAT
>probe:Drosophila_2:1626529_at:387:369; Interrogation_Position=827; Antisense; GAATGCGAGACTATGGCTACGAGAT
>probe:Drosophila_2:1626529_at:700:425; Interrogation_Position=847; Antisense; GAGATACCAGACTACATGGCGTATG
>probe:Drosophila_2:1626529_at:517:317; Interrogation_Position=892; Antisense; GCCGGAAGACCAAGAGCTCGCTACG
>probe:Drosophila_2:1626529_at:171:559; Interrogation_Position=918; Antisense; GGAAATCCGCTGCAACGGCTACTAG

Paste this into a BLAST search page for me
ACCTCAAGCGGTGTGCAACATCTGGGAGTGCGATCTCATTCCTAGCAAGACATCAAACCTTTACCGGGATTCCTGCAGGCCTTTGGTTCCACCGAAATAGGAAATAGGTCGCTTCTCCGAGCGTTTGCAAACGCCGGAATCCCTAGTAGAATATGCAGGCAGTGCACCCAACAACTTCAGCTGGAGGCTACATCGAGTCCACGCACAACTACTATCCTTATGAGGGAACCAAGGCGGCTATCCAAGGAATGAATGCGAGACTATGGCTACGAGATGAGATACCAGACTACATGGCGTATGGCCGGAAGACCAAGAGCTCGCTACGGGAAATCCGCTGCAACGGCTACTAG

Full Affymetrix probeset data:

Annotations for 1626529_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720