FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626530_at:

>probe:Drosophila_2:1626530_at:609:235; Interrogation_Position=108; Antisense; AATCGAACGCATTGGTCAGCATACC
>probe:Drosophila_2:1626530_at:20:199; Interrogation_Position=113; Antisense; AACGCATTGGTCAGCATACCAGGGA
>probe:Drosophila_2:1626530_at:156:497; Interrogation_Position=122; Antisense; GTCAGCATACCAGGGATGCCTCAAT
>probe:Drosophila_2:1626530_at:477:673; Interrogation_Position=129; Antisense; TACCAGGGATGCCTCAATCCAGGTC
>probe:Drosophila_2:1626530_at:3:449; Interrogation_Position=136; Antisense; GATGCCTCAATCCAGGTCCTCGGAA
>probe:Drosophila_2:1626530_at:391:235; Interrogation_Position=144; Antisense; AATCCAGGTCCTCGGAATCGCCCAA
>probe:Drosophila_2:1626530_at:34:71; Interrogation_Position=149; Antisense; AGGTCCTCGGAATCGCCCAACAGGC
>probe:Drosophila_2:1626530_at:127:385; Interrogation_Position=15; Antisense; GAACTTCAACAAGATCTTCGTCTTT
>probe:Drosophila_2:1626530_at:527:215; Interrogation_Position=25; Antisense; AAGATCTTCGTCTTTGTGGCACTCA
>probe:Drosophila_2:1626530_at:171:453; Interrogation_Position=27; Antisense; GATCTTCGTCTTTGTGGCACTCATC
>probe:Drosophila_2:1626530_at:179:499; Interrogation_Position=34; Antisense; GTCTTTGTGGCACTCATCCTGGCCA
>probe:Drosophila_2:1626530_at:633:43; Interrogation_Position=49; Antisense; ATCCTGGCCATCAGCCTGGGAAACT
>probe:Drosophila_2:1626530_at:359:579; Interrogation_Position=54; Antisense; GGCCATCAGCCTGGGAAACTCAGAG
>probe:Drosophila_2:1626530_at:599:145; Interrogation_Position=71; Antisense; ACTCAGAGGCTGGTTGGCTTAGGAA

Paste this into a BLAST search page for me
AATCGAACGCATTGGTCAGCATACCAACGCATTGGTCAGCATACCAGGGAGTCAGCATACCAGGGATGCCTCAATTACCAGGGATGCCTCAATCCAGGTCGATGCCTCAATCCAGGTCCTCGGAAAATCCAGGTCCTCGGAATCGCCCAAAGGTCCTCGGAATCGCCCAACAGGCGAACTTCAACAAGATCTTCGTCTTTAAGATCTTCGTCTTTGTGGCACTCAGATCTTCGTCTTTGTGGCACTCATCGTCTTTGTGGCACTCATCCTGGCCAATCCTGGCCATCAGCCTGGGAAACTGGCCATCAGCCTGGGAAACTCAGAGACTCAGAGGCTGGTTGGCTTAGGAA

Full Affymetrix probeset data:

Annotations for 1626530_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720