Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626531_at:

>probe:Drosophila_2:1626531_at:311:115; Interrogation_Position=1829; Antisense; AGCAGTTGTAAGGTGGCCCTGCTCT
>probe:Drosophila_2:1626531_at:501:619; Interrogation_Position=1848; Antisense; TGCTCTCCCTAAAAGCCTGCAATTC
>probe:Drosophila_2:1626531_at:565:659; Interrogation_Position=1878; Antisense; TAACGCTAACTGCAGCTGAGATCAT
>probe:Drosophila_2:1626531_at:502:513; Interrogation_Position=1904; Antisense; GTGTTCGCTGAACTGGACTGGAATC
>probe:Drosophila_2:1626531_at:164:587; Interrogation_Position=1917; Antisense; TGGACTGGAATCCTAGCACTCTTGC
>probe:Drosophila_2:1626531_at:206:507; Interrogation_Position=1956; Antisense; GTGCCCATCGCATTGGTCAGACAAA
>probe:Drosophila_2:1626531_at:104:183; Interrogation_Position=1978; Antisense; AAAACCGGTGATTTGTCGCTATCTG
>probe:Drosophila_2:1626531_at:372:599; Interrogation_Position=1991; Antisense; TGTCGCTATCTGATTGCTCACAATA
>probe:Drosophila_2:1626531_at:254:569; Interrogation_Position=2075; Antisense; GGCATCTTTGCCGAAAATCTTCAGA
>probe:Drosophila_2:1626531_at:321:215; Interrogation_Position=2135; Antisense; AAGATCGAGGAGTACTTCTCGCCCT
>probe:Drosophila_2:1626531_at:146:149; Interrogation_Position=2213; Antisense; ACTATTCCAGCTAAAGAGCCGCCTG
>probe:Drosophila_2:1626531_at:18:417; Interrogation_Position=2228; Antisense; GAGCCGCCTGAGCAAAATAATAATA
>probe:Drosophila_2:1626531_at:77:187; Interrogation_Position=2270; Antisense; AACAAGGCTGAGTCGGATATCGCGG
>probe:Drosophila_2:1626531_at:77:459; Interrogation_Position=2285; Antisense; GATATCGCGGCGTTCTTTAACGATG

Paste this into a BLAST search page for me
AGCAGTTGTAAGGTGGCCCTGCTCTTGCTCTCCCTAAAAGCCTGCAATTCTAACGCTAACTGCAGCTGAGATCATGTGTTCGCTGAACTGGACTGGAATCTGGACTGGAATCCTAGCACTCTTGCGTGCCCATCGCATTGGTCAGACAAAAAAACCGGTGATTTGTCGCTATCTGTGTCGCTATCTGATTGCTCACAATAGGCATCTTTGCCGAAAATCTTCAGAAAGATCGAGGAGTACTTCTCGCCCTACTATTCCAGCTAAAGAGCCGCCTGGAGCCGCCTGAGCAAAATAATAATAAACAAGGCTGAGTCGGATATCGCGGGATATCGCGGCGTTCTTTAACGATG

Full Affymetrix probeset data:

Annotations for 1626531_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime