Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626534_at:

>probe:Drosophila_2:1626534_at:668:577; Interrogation_Position=109; Antisense; GGCCGACTAAATAGCTTCCGAGCAA
>probe:Drosophila_2:1626534_at:511:419; Interrogation_Position=200; Antisense; GAGCATGAATTTTCTGCGGCAATCC
>probe:Drosophila_2:1626534_at:265:331; Interrogation_Position=215; Antisense; GCGGCAATCCTTTGGCATTACGAAA
>probe:Drosophila_2:1626534_at:722:389; Interrogation_Position=236; Antisense; GAAACAGTTGGCTTCGCAGGCCATC
>probe:Drosophila_2:1626534_at:306:269; Interrogation_Position=252; Antisense; CAGGCCATCCAGTGCAGCTATGAGA
>probe:Drosophila_2:1626534_at:229:681; Interrogation_Position=270; Antisense; TATGAGACCGCCGTCCGTGGAATGG
>probe:Drosophila_2:1626534_at:470:291; Interrogation_Position=285; Antisense; CGTGGAATGGCATCGCTGCAGCAGA
>probe:Drosophila_2:1626534_at:208:333; Interrogation_Position=356; Antisense; GCTGGATGGAAAGCCCTTCGCCAAG
>probe:Drosophila_2:1626534_at:482:719; Interrogation_Position=372; Antisense; TTCGCCAAGGGCGTTGTCCTGAAGA
>probe:Drosophila_2:1626534_at:2:45; Interrogation_Position=433; Antisense; ATCGAAAGTGCGTGCTGGTGCGCCT
>probe:Drosophila_2:1626534_at:670:41; Interrogation_Position=495; Antisense; ATCGGGCACAACCTGCAAGAGCACA
>probe:Drosophila_2:1626534_at:427:159; Interrogation_Position=517; Antisense; ACAACATTGTACTGTGCCGCGTGGG
>probe:Drosophila_2:1626534_at:25:325; Interrogation_Position=600; Antisense; GCGCACGTCGTCAAGAAGAGCCAAT
>probe:Drosophila_2:1626534_at:462:305; Interrogation_Position=634; Antisense; CCACTTCCTAATCACGTTGTTCAAA

Paste this into a BLAST search page for me
GGCCGACTAAATAGCTTCCGAGCAAGAGCATGAATTTTCTGCGGCAATCCGCGGCAATCCTTTGGCATTACGAAAGAAACAGTTGGCTTCGCAGGCCATCCAGGCCATCCAGTGCAGCTATGAGATATGAGACCGCCGTCCGTGGAATGGCGTGGAATGGCATCGCTGCAGCAGAGCTGGATGGAAAGCCCTTCGCCAAGTTCGCCAAGGGCGTTGTCCTGAAGAATCGAAAGTGCGTGCTGGTGCGCCTATCGGGCACAACCTGCAAGAGCACAACAACATTGTACTGTGCCGCGTGGGGCGCACGTCGTCAAGAAGAGCCAATCCACTTCCTAATCACGTTGTTCAAA

Full Affymetrix probeset data:

Annotations for 1626534_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime