FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626536_at:

>probe:Drosophila_2:1626536_at:649:635; Interrogation_Position=325; Antisense; TCGCTCATCGAGTCGCTGATTATTG
>probe:Drosophila_2:1626536_at:35:17; Interrogation_Position=343; Antisense; ATTATTGCCGAGTATCTGGACGATA
>probe:Drosophila_2:1626536_at:671:215; Interrogation_Position=367; Antisense; AAGTACCCGGAGAATCCGTTGCTGC
>probe:Drosophila_2:1626536_at:209:469; Interrogation_Position=384; Antisense; GTTGCTGCCCAAGGACCCATTGAAG
>probe:Drosophila_2:1626536_at:365:87; Interrogation_Position=454; Antisense; AGTGCCTTCATAAACATCCTTGTGC
>probe:Drosophila_2:1626536_at:241:639; Interrogation_Position=489; Antisense; TCTGGAGGATTACTGGACGGCACTT
>probe:Drosophila_2:1626536_at:405:555; Interrogation_Position=503; Antisense; GGACGGCACTTGATATCTTTGAGGA
>probe:Drosophila_2:1626536_at:657:353; Interrogation_Position=545; Antisense; GCACCCCATATTTTGGCGGCAACAA
>probe:Drosophila_2:1626536_at:306:205; Interrogation_Position=568; Antisense; AAGCCGGGATTCGTGGACTACATGA
>probe:Drosophila_2:1626536_at:492:381; Interrogation_Position=607; Antisense; GAACGCCTCTCTGTAATCGAGTTGA
>probe:Drosophila_2:1626536_at:245:87; Interrogation_Position=661; Antisense; AGTCGTTTCCCGAAGATCACCAAGT
>probe:Drosophila_2:1626536_at:331:83; Interrogation_Position=683; Antisense; AGTGGATTGCCCTCCTGAAGGCGGA
>probe:Drosophila_2:1626536_at:273:579; Interrogation_Position=771; Antisense; GGCCGGCAATGCAAACTACGATCTG
>probe:Drosophila_2:1626536_at:718:283; Interrogation_Position=793; Antisense; CTGCTGGCTTAGATCGGTACTGAAA

Paste this into a BLAST search page for me
TCGCTCATCGAGTCGCTGATTATTGATTATTGCCGAGTATCTGGACGATAAAGTACCCGGAGAATCCGTTGCTGCGTTGCTGCCCAAGGACCCATTGAAGAGTGCCTTCATAAACATCCTTGTGCTCTGGAGGATTACTGGACGGCACTTGGACGGCACTTGATATCTTTGAGGAGCACCCCATATTTTGGCGGCAACAAAAGCCGGGATTCGTGGACTACATGAGAACGCCTCTCTGTAATCGAGTTGAAGTCGTTTCCCGAAGATCACCAAGTAGTGGATTGCCCTCCTGAAGGCGGAGGCCGGCAATGCAAACTACGATCTGCTGCTGGCTTAGATCGGTACTGAAA

Full Affymetrix probeset data:

Annotations for 1626536_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720