FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626537_at:

>probe:Drosophila_2:1626537_at:236:649; Interrogation_Position=1486; Antisense; TCAGCCAGACGAAGGACACAGCAGG
>probe:Drosophila_2:1626537_at:141:103; Interrogation_Position=1512; Antisense; AGAGCTTGGCCAGGCGTCCAAGGAA
>probe:Drosophila_2:1626537_at:529:445; Interrogation_Position=1553; Antisense; GATCTCTAAGCCATTAAATTCGGGA
>probe:Drosophila_2:1626537_at:428:59; Interrogation_Position=1593; Antisense; ATGTTGCAGCACTTTGGTCGACGTA
>probe:Drosophila_2:1626537_at:715:509; Interrogation_Position=1622; Antisense; GTGAACGAACACAACGGACAAAATT
>probe:Drosophila_2:1626537_at:48:203; Interrogation_Position=1661; Antisense; AACCACACGCGAAACTCGTCGGAAT
>probe:Drosophila_2:1626537_at:551:15; Interrogation_Position=1714; Antisense; ATTTAAGCAGCCGAGCAAAGCAAAC
>probe:Drosophila_2:1626537_at:576:725; Interrogation_Position=1759; Antisense; TTGTGTGTATGTGTACTACGAGCCG
>probe:Drosophila_2:1626537_at:680:95; Interrogation_Position=1828; Antisense; AGATCAACCTGATCTACGCCCATTT
>probe:Drosophila_2:1626537_at:211:133; Interrogation_Position=1843; Antisense; ACGCCCATTTGATTAGTTATACGAA
>probe:Drosophila_2:1626537_at:670:703; Interrogation_Position=1859; Antisense; TTATACGAACACCAACACCCTTGAA
>probe:Drosophila_2:1626537_at:231:249; Interrogation_Position=1883; Antisense; AATTGGTCAATGTCGAGCTATAACT
>probe:Drosophila_2:1626537_at:617:27; Interrogation_Position=1932; Antisense; ATACGGTATCAAGGTAACGCGCGGA
>probe:Drosophila_2:1626537_at:232:493; Interrogation_Position=1945; Antisense; GTAACGCGCGGAAATTGCAAGCAAA

Paste this into a BLAST search page for me
TCAGCCAGACGAAGGACACAGCAGGAGAGCTTGGCCAGGCGTCCAAGGAAGATCTCTAAGCCATTAAATTCGGGAATGTTGCAGCACTTTGGTCGACGTAGTGAACGAACACAACGGACAAAATTAACCACACGCGAAACTCGTCGGAATATTTAAGCAGCCGAGCAAAGCAAACTTGTGTGTATGTGTACTACGAGCCGAGATCAACCTGATCTACGCCCATTTACGCCCATTTGATTAGTTATACGAATTATACGAACACCAACACCCTTGAAAATTGGTCAATGTCGAGCTATAACTATACGGTATCAAGGTAACGCGCGGAGTAACGCGCGGAAATTGCAAGCAAA

Full Affymetrix probeset data:

Annotations for 1626537_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720