FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626540_at:

>probe:Drosophila_2:1626540_at:446:451; Interrogation_Position=1312; Antisense; GATCTGGGACAATCGCCTCTAGAAA
>probe:Drosophila_2:1626540_at:533:165; Interrogation_Position=1334; Antisense; AAATCGGAGTTCAGGACACGCAATA
>probe:Drosophila_2:1626540_at:726:431; Interrogation_Position=1378; Antisense; GAGTCCACAGATCCCGTAACGAAGA
>probe:Drosophila_2:1626540_at:621:387; Interrogation_Position=1435; Antisense; GAAAATATCTATATGCGCCCCTTGC
>probe:Drosophila_2:1626540_at:537:47; Interrogation_Position=1447; Antisense; ATGCGCCCCTTGCTAGGAATGGAGA
>probe:Drosophila_2:1626540_at:8:325; Interrogation_Position=1476; Antisense; GCGAACCGGCTTATTTGCATACCAG
>probe:Drosophila_2:1626540_at:340:615; Interrogation_Position=1491; Antisense; TGCATACCAGGTTGAACTCCAGGCT
>probe:Drosophila_2:1626540_at:641:473; Interrogation_Position=1517; Antisense; GTTACCAAATCGTCAGCGACACCTT
>probe:Drosophila_2:1626540_at:274:625; Interrogation_Position=1589; Antisense; TGCCCATGCTAGCTATTCCAACAAG
>probe:Drosophila_2:1626540_at:191:11; Interrogation_Position=1639; Antisense; ATTCGAAGGCAACTACGCTGGCAGC
>probe:Drosophila_2:1626540_at:187:221; Interrogation_Position=1696; Antisense; AAGTGGATTCCTCAGAAGCCCAAAT
>probe:Drosophila_2:1626540_at:271:331; Interrogation_Position=1736; Antisense; GCGGATTTGTCTCCATTGGCATTAC
>probe:Drosophila_2:1626540_at:694:595; Interrogation_Position=1792; Antisense; TGTGGAGCTGCTGTCAGTTTTGTCC
>probe:Drosophila_2:1626540_at:507:263; Interrogation_Position=1806; Antisense; CAGTTTTGTCCTGTTTCTTTTCGAG

Paste this into a BLAST search page for me
GATCTGGGACAATCGCCTCTAGAAAAAATCGGAGTTCAGGACACGCAATAGAGTCCACAGATCCCGTAACGAAGAGAAAATATCTATATGCGCCCCTTGCATGCGCCCCTTGCTAGGAATGGAGAGCGAACCGGCTTATTTGCATACCAGTGCATACCAGGTTGAACTCCAGGCTGTTACCAAATCGTCAGCGACACCTTTGCCCATGCTAGCTATTCCAACAAGATTCGAAGGCAACTACGCTGGCAGCAAGTGGATTCCTCAGAAGCCCAAATGCGGATTTGTCTCCATTGGCATTACTGTGGAGCTGCTGTCAGTTTTGTCCCAGTTTTGTCCTGTTTCTTTTCGAG

Full Affymetrix probeset data:

Annotations for 1626540_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720