FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626543_at:

>probe:Drosophila_2:1626543_at:560:219; Interrogation_Position=1020; Antisense; AAGTGCCAGGAGGACGTGCTCGAAA
>probe:Drosophila_2:1626543_at:563:313; Interrogation_Position=514; Antisense; GCCATTCACTCACGGCGATTTAGAA
>probe:Drosophila_2:1626543_at:38:209; Interrogation_Position=537; Antisense; AAGCTATTGTGACAACTGCACCCGT
>probe:Drosophila_2:1626543_at:650:545; Interrogation_Position=603; Antisense; GGATCGATTTCAGAAGCGCGCCTTT
>probe:Drosophila_2:1626543_at:660:95; Interrogation_Position=638; Antisense; AGATTAAAGCGCGTGCACATCCCCG
>probe:Drosophila_2:1626543_at:245:631; Interrogation_Position=725; Antisense; TCCTGGCCACTGACTGCGAAATCTG
>probe:Drosophila_2:1626543_at:540:39; Interrogation_Position=745; Antisense; ATCTGCCCCGGCGAAAGTGGTCTAG
>probe:Drosophila_2:1626543_at:304:687; Interrogation_Position=820; Antisense; TATTGCTTTCCTCTGCTGAGAAGGG
>probe:Drosophila_2:1626543_at:364:107; Interrogation_Position=838; Antisense; AGAAGGGAGCTTTCTTATGCCCTCC
>probe:Drosophila_2:1626543_at:542:683; Interrogation_Position=853; Antisense; TATGCCCTCCAAAAGCGAGCGCAAA
>probe:Drosophila_2:1626543_at:319:243; Interrogation_Position=876; Antisense; AATTTGTTGCGTTGCTATCCTTGAC
>probe:Drosophila_2:1626543_at:78:341; Interrogation_Position=889; Antisense; GCTATCCTTGACTTTGACGGAGCGA
>probe:Drosophila_2:1626543_at:156:367; Interrogation_Position=912; Antisense; GAATGCAACCTACGCAGATCTTCTT
>probe:Drosophila_2:1626543_at:116:437; Interrogation_Position=946; Antisense; GAGGATGCCCGTGCGGAGTACAAAC

Paste this into a BLAST search page for me
AAGTGCCAGGAGGACGTGCTCGAAAGCCATTCACTCACGGCGATTTAGAAAAGCTATTGTGACAACTGCACCCGTGGATCGATTTCAGAAGCGCGCCTTTAGATTAAAGCGCGTGCACATCCCCGTCCTGGCCACTGACTGCGAAATCTGATCTGCCCCGGCGAAAGTGGTCTAGTATTGCTTTCCTCTGCTGAGAAGGGAGAAGGGAGCTTTCTTATGCCCTCCTATGCCCTCCAAAAGCGAGCGCAAAAATTTGTTGCGTTGCTATCCTTGACGCTATCCTTGACTTTGACGGAGCGAGAATGCAACCTACGCAGATCTTCTTGAGGATGCCCGTGCGGAGTACAAAC

Full Affymetrix probeset data:

Annotations for 1626543_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720