FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626544_at:

>probe:Drosophila_2:1626544_at:649:181; Interrogation_Position=115; Antisense; AAAACAATCATGATCCCTCGTCGTC
>probe:Drosophila_2:1626544_at:103:565; Interrogation_Position=150; Antisense; GGCAACACCAATGTCCAGGAGGCGG
>probe:Drosophila_2:1626544_at:482:511; Interrogation_Position=195; Antisense; GTGAACAACAGTCTGGACGCTCTCA
>probe:Drosophila_2:1626544_at:359:649; Interrogation_Position=217; Antisense; TCAGCTGTGCCCTGGACGCCGTGGA
>probe:Drosophila_2:1626544_at:569:133; Interrogation_Position=232; Antisense; ACGCCGTGGAGCAGCGCACAGACGA
>probe:Drosophila_2:1626544_at:516:407; Interrogation_Position=252; Antisense; GACGACATTATGTCCCAACTACGGG
>probe:Drosophila_2:1626544_at:430:43; Interrogation_Position=26; Antisense; ATCGTTTATAGCTATCCCGTGACAA
>probe:Drosophila_2:1626544_at:668:191; Interrogation_Position=268; Antisense; AACTACGGGAGCTGCTGAACTCCAA
>probe:Drosophila_2:1626544_at:642:45; Interrogation_Position=300; Antisense; ATCCGTCGCCTGATTGCCGAGGAAA
>probe:Drosophila_2:1626544_at:362:181; Interrogation_Position=322; Antisense; AAAATGACAACGCTCCCGAATCGGG
>probe:Drosophila_2:1626544_at:152:351; Interrogation_Position=373; Antisense; GCAGCGAAGCGGCACCCAAGTAGAT
>probe:Drosophila_2:1626544_at:309:447; Interrogation_Position=395; Antisense; GATCCCTCTACGAGAAGTTATTGTT
>probe:Drosophila_2:1626544_at:622:471; Interrogation_Position=422; Antisense; GTTCATCCAAATCGTTTTTAGGCAC
>probe:Drosophila_2:1626544_at:385:269; Interrogation_Position=473; Antisense; CATGTATTTTTGTCCTAAGTCCTAA

Paste this into a BLAST search page for me
AAAACAATCATGATCCCTCGTCGTCGGCAACACCAATGTCCAGGAGGCGGGTGAACAACAGTCTGGACGCTCTCATCAGCTGTGCCCTGGACGCCGTGGAACGCCGTGGAGCAGCGCACAGACGAGACGACATTATGTCCCAACTACGGGATCGTTTATAGCTATCCCGTGACAAAACTACGGGAGCTGCTGAACTCCAAATCCGTCGCCTGATTGCCGAGGAAAAAAATGACAACGCTCCCGAATCGGGGCAGCGAAGCGGCACCCAAGTAGATGATCCCTCTACGAGAAGTTATTGTTGTTCATCCAAATCGTTTTTAGGCACCATGTATTTTTGTCCTAAGTCCTAA

Full Affymetrix probeset data:

Annotations for 1626544_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720