Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626546_s_at:

>probe:Drosophila_2:1626546_s_at:541:95; Interrogation_Position=1045; Antisense; AGATACCAAGGTCCACAGTCCAGAA
>probe:Drosophila_2:1626546_s_at:319:155; Interrogation_Position=1146; Antisense; ACAGATCAACTGTCCGCTTGTATTA
>probe:Drosophila_2:1626546_s_at:419:581; Interrogation_Position=1288; Antisense; TGTAAATTTCCTCTTAAGCCACCGT
>probe:Drosophila_2:1626546_s_at:711:201; Interrogation_Position=1303; Antisense; AAGCCACCGTTATCAACAACCCATT
>probe:Drosophila_2:1626546_s_at:394:441; Interrogation_Position=1376; Antisense; GATGTCTGTCCATTGTTGTTTTCAA
>probe:Drosophila_2:1626546_s_at:322:493; Interrogation_Position=825; Antisense; GTAAGGAGTGCACAATCTTCCCGAC
>probe:Drosophila_2:1626546_s_at:164:639; Interrogation_Position=840; Antisense; TCTTCCCGACCATTACGAATCTGTA
>probe:Drosophila_2:1626546_s_at:440:367; Interrogation_Position=856; Antisense; GAATCTGTACAACCAGGGATGCCTC
>probe:Drosophila_2:1626546_s_at:64:83; Interrogation_Position=870; Antisense; AGGGATGCCTCTATGTGACGACCAA
>probe:Drosophila_2:1626546_s_at:365:511; Interrogation_Position=884; Antisense; GTGACGACCAACTTCATCAGGGATC
>probe:Drosophila_2:1626546_s_at:146:35; Interrogation_Position=906; Antisense; ATCACGCGGCGGTTATTGGAGGTAC
>probe:Drosophila_2:1626546_s_at:646:435; Interrogation_Position=924; Antisense; GAGGTACATCCATAGCGGTGGCCAT
>probe:Drosophila_2:1626546_s_at:173:291; Interrogation_Position=939; Antisense; CGGTGGCCATACTGATGATCTTTGG
>probe:Drosophila_2:1626546_s_at:669:583; Interrogation_Position=961; Antisense; TGGCATGATATTCTCCTGTCTACTA

Paste this into a BLAST search page for me
AGATACCAAGGTCCACAGTCCAGAAACAGATCAACTGTCCGCTTGTATTATGTAAATTTCCTCTTAAGCCACCGTAAGCCACCGTTATCAACAACCCATTGATGTCTGTCCATTGTTGTTTTCAAGTAAGGAGTGCACAATCTTCCCGACTCTTCCCGACCATTACGAATCTGTAGAATCTGTACAACCAGGGATGCCTCAGGGATGCCTCTATGTGACGACCAAGTGACGACCAACTTCATCAGGGATCATCACGCGGCGGTTATTGGAGGTACGAGGTACATCCATAGCGGTGGCCATCGGTGGCCATACTGATGATCTTTGGTGGCATGATATTCTCCTGTCTACTA

Full Affymetrix probeset data:

Annotations for 1626546_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime