Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626549_at:

>probe:Drosophila_2:1626549_at:549:191; Interrogation_Position=1903; Antisense; AACTTTGAGATGTCGGCGCGGCTGT
>probe:Drosophila_2:1626549_at:487:359; Interrogation_Position=1940; Antisense; GCAAGTACAACCTGGCCGTGAAGCA
>probe:Drosophila_2:1626549_at:686:317; Interrogation_Position=1954; Antisense; GCCGTGAAGCACATCTGCATTCTGA
>probe:Drosophila_2:1626549_at:242:11; Interrogation_Position=1972; Antisense; ATTCTGATGGCCCAGGTGGTGCACC
>probe:Drosophila_2:1626549_at:530:315; Interrogation_Position=2027; Antisense; GCCTTGGCCAAGACGCTCAGAGATT
>probe:Drosophila_2:1626549_at:178:117; Interrogation_Position=2104; Antisense; AGCTTTGTGCTGCTGCAGGATCTGC
>probe:Drosophila_2:1626549_at:588:77; Interrogation_Position=2120; Antisense; AGGATCTGCTTATCTTCTTCAACTT
>probe:Drosophila_2:1626549_at:303:467; Interrogation_Position=2172; Antisense; GTTGGATCTGCTCAGGCAAACCCAG
>probe:Drosophila_2:1626549_at:224:467; Interrogation_Position=2196; Antisense; GTTGGTGCCCAATACGTTGGACGAT
>probe:Drosophila_2:1626549_at:589:409; Interrogation_Position=2215; Antisense; GACGATGTCGATGTTGTACTGGGCA
>probe:Drosophila_2:1626549_at:528:325; Interrogation_Position=2258; Antisense; GCGAGGTAATCAAGGTCCTGCCCGA
>probe:Drosophila_2:1626549_at:538:297; Interrogation_Position=2279; Antisense; CCGACGTTATAGTGGCCGCCATGGA
>probe:Drosophila_2:1626549_at:158:561; Interrogation_Position=2355; Antisense; GGAACAGACCCAGATGCAGCAACTC
>probe:Drosophila_2:1626549_at:529:383; Interrogation_Position=2461; Antisense; GAACTCGAACTGGATATGCACTAAA

Paste this into a BLAST search page for me
AACTTTGAGATGTCGGCGCGGCTGTGCAAGTACAACCTGGCCGTGAAGCAGCCGTGAAGCACATCTGCATTCTGAATTCTGATGGCCCAGGTGGTGCACCGCCTTGGCCAAGACGCTCAGAGATTAGCTTTGTGCTGCTGCAGGATCTGCAGGATCTGCTTATCTTCTTCAACTTGTTGGATCTGCTCAGGCAAACCCAGGTTGGTGCCCAATACGTTGGACGATGACGATGTCGATGTTGTACTGGGCAGCGAGGTAATCAAGGTCCTGCCCGACCGACGTTATAGTGGCCGCCATGGAGGAACAGACCCAGATGCAGCAACTCGAACTCGAACTGGATATGCACTAAA

Full Affymetrix probeset data:

Annotations for 1626549_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime