Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626550_at:

>probe:Drosophila_2:1626550_at:222:533; Interrogation_Position=3999; Antisense; GGTGGTGCCTGTGCTCCTGATGCCA
>probe:Drosophila_2:1626550_at:330:385; Interrogation_Position=4358; Antisense; GAACTAGCCCTAGTTCGTGACCTTT
>probe:Drosophila_2:1626550_at:174:419; Interrogation_Position=4408; Antisense; GAGCATGTAAGGGTGTATCTATCTA
>probe:Drosophila_2:1626550_at:579:531; Interrogation_Position=4418; Antisense; GGGTGTATCTATCTAACTAGAGCTA
>probe:Drosophila_2:1626550_at:241:147; Interrogation_Position=4433; Antisense; ACTAGAGCTATTTACACCAGATGTG
>probe:Drosophila_2:1626550_at:633:307; Interrogation_Position=4449; Antisense; CCAGATGTGTGTGTATATAAGTTGC
>probe:Drosophila_2:1626550_at:529:31; Interrogation_Position=4465; Antisense; ATAAGTTGCACTGCTGTTGTAGCTA
>probe:Drosophila_2:1626550_at:626:353; Interrogation_Position=4472; Antisense; GCACTGCTGTTGTAGCTATTGCTAA
>probe:Drosophila_2:1626550_at:363:485; Interrogation_Position=4483; Antisense; GTAGCTATTGCTAAACTTTAAGTAA
>probe:Drosophila_2:1626550_at:597:243; Interrogation_Position=4519; Antisense; AATTTTTACGCTTTGTTATTATGAT
>probe:Drosophila_2:1626550_at:506:699; Interrogation_Position=4551; Antisense; TTTTTTAATGCACTTTGGAAGACGT
>probe:Drosophila_2:1626550_at:493:313; Interrogation_Position=4560; Antisense; GCACTTTGGAAGACGTTTTACACGA
>probe:Drosophila_2:1626550_at:467:563; Interrogation_Position=4567; Antisense; GGAAGACGTTTTACACGATCCGATA
>probe:Drosophila_2:1626550_at:703:101; Interrogation_Position=4570; Antisense; AGACGTTTTACACGATCCGATATCG

Paste this into a BLAST search page for me
GGTGGTGCCTGTGCTCCTGATGCCAGAACTAGCCCTAGTTCGTGACCTTTGAGCATGTAAGGGTGTATCTATCTAGGGTGTATCTATCTAACTAGAGCTAACTAGAGCTATTTACACCAGATGTGCCAGATGTGTGTGTATATAAGTTGCATAAGTTGCACTGCTGTTGTAGCTAGCACTGCTGTTGTAGCTATTGCTAAGTAGCTATTGCTAAACTTTAAGTAAAATTTTTACGCTTTGTTATTATGATTTTTTTAATGCACTTTGGAAGACGTGCACTTTGGAAGACGTTTTACACGAGGAAGACGTTTTACACGATCCGATAAGACGTTTTACACGATCCGATATCG

Full Affymetrix probeset data:

Annotations for 1626550_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime