Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626553_at:

>probe:Drosophila_2:1626553_at:100:27; Interrogation_Position=1989; Antisense; ATAGCTTGGAGCTGTTCGGAGTGCT
>probe:Drosophila_2:1626553_at:676:431; Interrogation_Position=2007; Antisense; GAGTGCTCCTACCTTTATTGTCACA
>probe:Drosophila_2:1626553_at:274:703; Interrogation_Position=2021; Antisense; TTATTGTCACATTCTCACGTGCCTA
>probe:Drosophila_2:1626553_at:349:139; Interrogation_Position=2037; Antisense; ACGTGCCTACGTGGTCCTGAATATG
>probe:Drosophila_2:1626553_at:378:615; Interrogation_Position=2054; Antisense; TGAATATGGATGACCCCATCCCGGT
>probe:Drosophila_2:1626553_at:656:535; Interrogation_Position=2076; Antisense; GGTCCACTTGTTTGGTTGCTCGAAT
>probe:Drosophila_2:1626553_at:517:243; Interrogation_Position=2113; Antisense; AATATTTTGTGGTTGCTCAGCAGTT
>probe:Drosophila_2:1626553_at:572:71; Interrogation_Position=2159; Antisense; AGGCAACTGTTGTTAGCCCAATAGT
>probe:Drosophila_2:1626553_at:154:273; Interrogation_Position=2261; Antisense; CATTGAAGTTGTTTTCGGCCGCTTA
>probe:Drosophila_2:1626553_at:199:299; Interrogation_Position=2280; Antisense; CGCTTAGTGCTTCCTGCTGTACGAT
>probe:Drosophila_2:1626553_at:285:657; Interrogation_Position=2307; Antisense; TAAGCCAAGCCATGTAGCCAGGTAC
>probe:Drosophila_2:1626553_at:103:493; Interrogation_Position=2369; Antisense; GTAACCGTATTTAATGATCCCACAC
>probe:Drosophila_2:1626553_at:232:49; Interrogation_Position=2417; Antisense; ATCCAACGAACCTTTCATGCATTTT
>probe:Drosophila_2:1626553_at:18:265; Interrogation_Position=2432; Antisense; CATGCATTTTATCGAACAACCCAGG

Paste this into a BLAST search page for me
ATAGCTTGGAGCTGTTCGGAGTGCTGAGTGCTCCTACCTTTATTGTCACATTATTGTCACATTCTCACGTGCCTAACGTGCCTACGTGGTCCTGAATATGTGAATATGGATGACCCCATCCCGGTGGTCCACTTGTTTGGTTGCTCGAATAATATTTTGTGGTTGCTCAGCAGTTAGGCAACTGTTGTTAGCCCAATAGTCATTGAAGTTGTTTTCGGCCGCTTACGCTTAGTGCTTCCTGCTGTACGATTAAGCCAAGCCATGTAGCCAGGTACGTAACCGTATTTAATGATCCCACACATCCAACGAACCTTTCATGCATTTTCATGCATTTTATCGAACAACCCAGG

Full Affymetrix probeset data:

Annotations for 1626553_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime