FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626556_at:

>probe:Drosophila_2:1626556_at:592:189; Interrogation_Position=100; Antisense; AACATGGCCATCCTGCCGCTGAGGA
>probe:Drosophila_2:1626556_at:160:309; Interrogation_Position=139; Antisense; CCAGCGCCCAGTGCGAATATTGAGA
>probe:Drosophila_2:1626556_at:134:317; Interrogation_Position=15; Antisense; GCCGGTTAGTGGATACTTGCGCATC
>probe:Drosophila_2:1626556_at:460:241; Interrogation_Position=154; Antisense; AATATTGAGAGCGACATCATTGATG
>probe:Drosophila_2:1626556_at:492:35; Interrogation_Position=169; Antisense; ATCATTGATGAGTCACTGTACTACT
>probe:Drosophila_2:1626556_at:414:495; Interrogation_Position=180; Antisense; GTCACTGTACTACTTCAAAGCCAAT
>probe:Drosophila_2:1626556_at:281:175; Interrogation_Position=196; Antisense; AAAGCCAATGTCTTCTTTCGCACGT
>probe:Drosophila_2:1626556_at:265:231; Interrogation_Position=202; Antisense; AATGTCTTCTTTCGCACGTACGAAA
>probe:Drosophila_2:1626556_at:649:679; Interrogation_Position=21; Antisense; TAGTGGATACTTGCGCATCAAAGGC
>probe:Drosophila_2:1626556_at:73:487; Interrogation_Position=219; Antisense; GTACGAAATCAAGTCCGACGTGGAT
>probe:Drosophila_2:1626556_at:615:345; Interrogation_Position=35; Antisense; GCATCAAAGGCAAACGAGTTGGCGT
>probe:Drosophila_2:1626556_at:726:465; Interrogation_Position=52; Antisense; GTTGGCGTTGAGATATTCCCAATCA
>probe:Drosophila_2:1626556_at:568:9; Interrogation_Position=66; Antisense; ATTCCCAATCAAGGAAGTGCGCCAG
>probe:Drosophila_2:1626556_at:574:219; Interrogation_Position=80; Antisense; AAGTGCGCCAGCAGGTGGGCAACAT

Paste this into a BLAST search page for me
AACATGGCCATCCTGCCGCTGAGGACCAGCGCCCAGTGCGAATATTGAGAGCCGGTTAGTGGATACTTGCGCATCAATATTGAGAGCGACATCATTGATGATCATTGATGAGTCACTGTACTACTGTCACTGTACTACTTCAAAGCCAATAAAGCCAATGTCTTCTTTCGCACGTAATGTCTTCTTTCGCACGTACGAAATAGTGGATACTTGCGCATCAAAGGCGTACGAAATCAAGTCCGACGTGGATGCATCAAAGGCAAACGAGTTGGCGTGTTGGCGTTGAGATATTCCCAATCAATTCCCAATCAAGGAAGTGCGCCAGAAGTGCGCCAGCAGGTGGGCAACAT

Full Affymetrix probeset data:

Annotations for 1626556_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720