FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626558_at:

>probe:Drosophila_2:1626558_at:190:263; Interrogation_Position=1049; Antisense; CAGCACCGAAGGTTGAGTACCTGCC
>probe:Drosophila_2:1626558_at:278:81; Interrogation_Position=1091; Antisense; AGGTGTACGTCGCTCCCCCAGTCTA
>probe:Drosophila_2:1626558_at:536:57; Interrogation_Position=1122; Antisense; ACCACCCACCAAGAAGGTCGTTGTG
>probe:Drosophila_2:1626558_at:98:259; Interrogation_Position=1124; Antisense; CACCCACCAAGAAGGTCGTTGTGTA
>probe:Drosophila_2:1626558_at:688:299; Interrogation_Position=1126; Antisense; CCCACCAAGAAGGTCGTTGTGTACA
>probe:Drosophila_2:1626558_at:581:251; Interrogation_Position=1131; Antisense; CAAGAAGGTCGTTGTGTACACCCCA
>probe:Drosophila_2:1626558_at:239:369; Interrogation_Position=1134; Antisense; GAAGGTCGTTGTGTACACCCCACCT
>probe:Drosophila_2:1626558_at:190:249; Interrogation_Position=1239; Antisense; CAAGAAGGTGTACGTGACCCCCAAG
>probe:Drosophila_2:1626558_at:56:505; Interrogation_Position=1252; Antisense; GTGACCCCCAAGGTCGAGTACCTGC
>probe:Drosophila_2:1626558_at:248:305; Interrogation_Position=1274; Antisense; TGCCCCCCGTCCAGAAGGGATACAG
>probe:Drosophila_2:1626558_at:142:503; Interrogation_Position=1282; Antisense; GTCCAGAAGGGATACAGCTACCCCA
>probe:Drosophila_2:1626558_at:726:99; Interrogation_Position=1286; Antisense; AGAAGGGATACAGCTACCCCAACGA
>probe:Drosophila_2:1626558_at:628:371; Interrogation_Position=1287; Antisense; GAAGGGATACAGCTACCCCAACGAC
>probe:Drosophila_2:1626558_at:170:251; Interrogation_Position=756; Antisense; CAAGGTTGAGTACCTGCCTCCTCCG

Paste this into a BLAST search page for me
CAGCACCGAAGGTTGAGTACCTGCCAGGTGTACGTCGCTCCCCCAGTCTAACCACCCACCAAGAAGGTCGTTGTGCACCCACCAAGAAGGTCGTTGTGTACCCACCAAGAAGGTCGTTGTGTACACAAGAAGGTCGTTGTGTACACCCCAGAAGGTCGTTGTGTACACCCCACCTCAAGAAGGTGTACGTGACCCCCAAGGTGACCCCCAAGGTCGAGTACCTGCTGCCCCCCGTCCAGAAGGGATACAGGTCCAGAAGGGATACAGCTACCCCAAGAAGGGATACAGCTACCCCAACGAGAAGGGATACAGCTACCCCAACGACCAAGGTTGAGTACCTGCCTCCTCCG

Full Affymetrix probeset data:

Annotations for 1626558_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720