FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626560_at:

>probe:Drosophila_2:1626560_at:102:647; Interrogation_Position=1020; Antisense; TCATCTTCTGTATCCAATTGGCAGG
>probe:Drosophila_2:1626560_at:293:325; Interrogation_Position=1050; Antisense; GCGAATCGGGCTCAAATGCTAATGA
>probe:Drosophila_2:1626560_at:723:9; Interrogation_Position=1116; Antisense; ATTCTACTACTGTGCACTTTGTTCA
>probe:Drosophila_2:1626560_at:656:309; Interrogation_Position=708; Antisense; CCACCTGGAGCACATCATTGTCTAT
>probe:Drosophila_2:1626560_at:550:37; Interrogation_Position=721; Antisense; ATCATTGTCTATTGGATCGGCGCCT
>probe:Drosophila_2:1626560_at:353:7; Interrogation_Position=766; Antisense; ATTCCGGTCTTCAAGGTGCCCGCGG
>probe:Drosophila_2:1626560_at:81:121; Interrogation_Position=816; Antisense; AGCGGCGTCGAAGTCCAAGCAGGAA
>probe:Drosophila_2:1626560_at:25:315; Interrogation_Position=856; Antisense; GCCTTTGTATATCAAGTATCCGCCA
>probe:Drosophila_2:1626560_at:729:483; Interrogation_Position=871; Antisense; GTATCCGCCAATATCTAGTTTGAAA
>probe:Drosophila_2:1626560_at:642:387; Interrogation_Position=892; Antisense; GAAAAGGGCATGTCTGTCCAGCGGT
>probe:Drosophila_2:1626560_at:263:505; Interrogation_Position=907; Antisense; GTCCAGCGGTAAGGTTTCAGTCTCT
>probe:Drosophila_2:1626560_at:668:539; Interrogation_Position=919; Antisense; GGTTTCAGTCTCTTAGTACCTAAAG
>probe:Drosophila_2:1626560_at:24:379; Interrogation_Position=955; Antisense; GAAGCTATTGCTTGGGCTACATAGT
>probe:Drosophila_2:1626560_at:718:23; Interrogation_Position=975; Antisense; ATAGTTTGAGATACCCTCCATCCAC

Paste this into a BLAST search page for me
TCATCTTCTGTATCCAATTGGCAGGGCGAATCGGGCTCAAATGCTAATGAATTCTACTACTGTGCACTTTGTTCACCACCTGGAGCACATCATTGTCTATATCATTGTCTATTGGATCGGCGCCTATTCCGGTCTTCAAGGTGCCCGCGGAGCGGCGTCGAAGTCCAAGCAGGAAGCCTTTGTATATCAAGTATCCGCCAGTATCCGCCAATATCTAGTTTGAAAGAAAAGGGCATGTCTGTCCAGCGGTGTCCAGCGGTAAGGTTTCAGTCTCTGGTTTCAGTCTCTTAGTACCTAAAGGAAGCTATTGCTTGGGCTACATAGTATAGTTTGAGATACCCTCCATCCAC

Full Affymetrix probeset data:

Annotations for 1626560_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720