Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626561_at:

>probe:Drosophila_2:1626561_at:604:39; Interrogation_Position=4165; Antisense; ATCGAATTCGTCTCGGTTGTTAGAA
>probe:Drosophila_2:1626561_at:54:257; Interrogation_Position=4206; Antisense; CACACTTGGTATTTGCTTTGGCTAC
>probe:Drosophila_2:1626561_at:586:341; Interrogation_Position=4220; Antisense; GCTTTGGCTACCAAAACGCCAGGAT
>probe:Drosophila_2:1626561_at:231:707; Interrogation_Position=4259; Antisense; TTACGTGTACATCTGTTTGACCAAG
>probe:Drosophila_2:1626561_at:239:631; Interrogation_Position=4286; Antisense; TCCGGCTCCGGCATTGTATTTCGGT
>probe:Drosophila_2:1626561_at:614:687; Interrogation_Position=4314; Antisense; TATTTGGACTGTAACGCCGCCCGAG
>probe:Drosophila_2:1626561_at:151:405; Interrogation_Position=4353; Antisense; GACTCTCATCGAGTCCAGGACAACA
>probe:Drosophila_2:1626561_at:514:173; Interrogation_Position=4393; Antisense; AAACGCATCCGCACTTCAATTAACT
>probe:Drosophila_2:1626561_at:58:655; Interrogation_Position=4421; Antisense; TAATTGATGTGCATTGTGGCTCTAA
>probe:Drosophila_2:1626561_at:557:199; Interrogation_Position=4448; Antisense; AACCAAATTAGCTACACGCGGCGGA
>probe:Drosophila_2:1626561_at:276:261; Interrogation_Position=4462; Antisense; CACGCGGCGGAGAAGCTTTGTAACA
>probe:Drosophila_2:1626561_at:323:727; Interrogation_Position=4479; Antisense; TTGTAACATGGATGACGACGACGGC
>probe:Drosophila_2:1626561_at:215:297; Interrogation_Position=4503; Antisense; CGACACGTGGCTGCTGGTGTGAATT
>probe:Drosophila_2:1626561_at:468:527; Interrogation_Position=4542; Antisense; GGGATAGATTTTCTTCTCATGTAAG

Paste this into a BLAST search page for me
ATCGAATTCGTCTCGGTTGTTAGAACACACTTGGTATTTGCTTTGGCTACGCTTTGGCTACCAAAACGCCAGGATTTACGTGTACATCTGTTTGACCAAGTCCGGCTCCGGCATTGTATTTCGGTTATTTGGACTGTAACGCCGCCCGAGGACTCTCATCGAGTCCAGGACAACAAAACGCATCCGCACTTCAATTAACTTAATTGATGTGCATTGTGGCTCTAAAACCAAATTAGCTACACGCGGCGGACACGCGGCGGAGAAGCTTTGTAACATTGTAACATGGATGACGACGACGGCCGACACGTGGCTGCTGGTGTGAATTGGGATAGATTTTCTTCTCATGTAAG

Full Affymetrix probeset data:

Annotations for 1626561_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime