Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626563_at:

>probe:Drosophila_2:1626563_at:308:653; Interrogation_Position=1484; Antisense; TCAAGCATTGTAACCCTGTCATCCA
>probe:Drosophila_2:1626563_at:288:599; Interrogation_Position=1500; Antisense; TGTCATCCAACACTATCAACACGGC
>probe:Drosophila_2:1626563_at:556:155; Interrogation_Position=1547; Antisense; ACAGCAACAACCATCGGACGAGTGT
>probe:Drosophila_2:1626563_at:223:31; Interrogation_Position=1625; Antisense; ATAAGAGCCATTCAGGCCAACCAGC
>probe:Drosophila_2:1626563_at:519:189; Interrogation_Position=1643; Antisense; AACCAGCCGGCGCAAAAGTTTGTGA
>probe:Drosophila_2:1626563_at:137:727; Interrogation_Position=1662; Antisense; TTGTGATAGTCACCCAGAACTCGCC
>probe:Drosophila_2:1626563_at:511:383; Interrogation_Position=1780; Antisense; GAACTCAAGCTCGAGCGGCAGTCTA
>probe:Drosophila_2:1626563_at:477:475; Interrogation_Position=1841; Antisense; GTTATTGCCGGTAGCGAAGCGCCAG
>probe:Drosophila_2:1626563_at:257:239; Interrogation_Position=1887; Antisense; AATCTTTCAGAGCATCCTAGACGCC
>probe:Drosophila_2:1626563_at:676:411; Interrogation_Position=1906; Antisense; GACGCCAACTCGCTGATCATTGAGA
>probe:Drosophila_2:1626563_at:419:725; Interrogation_Position=1925; Antisense; TTGAGACGGAGATTGTGCGCGCACC
>probe:Drosophila_2:1626563_at:393:587; Interrogation_Position=1958; Antisense; TGGACGATCTCTCGCACCTGGAGTA
>probe:Drosophila_2:1626563_at:195:431; Interrogation_Position=1978; Antisense; GAGTAGCCAGCTTAGTTCGTAGTCC
>probe:Drosophila_2:1626563_at:106:677; Interrogation_Position=1990; Antisense; TAGTTCGTAGTCCACATTTTGTCAT

Paste this into a BLAST search page for me
TCAAGCATTGTAACCCTGTCATCCATGTCATCCAACACTATCAACACGGCACAGCAACAACCATCGGACGAGTGTATAAGAGCCATTCAGGCCAACCAGCAACCAGCCGGCGCAAAAGTTTGTGATTGTGATAGTCACCCAGAACTCGCCGAACTCAAGCTCGAGCGGCAGTCTAGTTATTGCCGGTAGCGAAGCGCCAGAATCTTTCAGAGCATCCTAGACGCCGACGCCAACTCGCTGATCATTGAGATTGAGACGGAGATTGTGCGCGCACCTGGACGATCTCTCGCACCTGGAGTAGAGTAGCCAGCTTAGTTCGTAGTCCTAGTTCGTAGTCCACATTTTGTCAT

Full Affymetrix probeset data:

Annotations for 1626563_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime