Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626565_at:

>probe:Drosophila_2:1626565_at:152:211; Interrogation_Position=1200; Antisense; AAGAAGAATCTTCGCTAGCCAAACG
>probe:Drosophila_2:1626565_at:728:71; Interrogation_Position=1242; Antisense; AGGCAAGGAAGTCAGCTGTCAAGCA
>probe:Drosophila_2:1626565_at:536:349; Interrogation_Position=1281; Antisense; GCAGTGACGAACCAGATGAGCCAAT
>probe:Drosophila_2:1626565_at:520:101; Interrogation_Position=1417; Antisense; AGAGCAAACTGTTTCGGAACCGAAT
>probe:Drosophila_2:1626565_at:105:565; Interrogation_Position=1450; Antisense; GGCAACAGTGGCTCCCAAAAGCGGA
>probe:Drosophila_2:1626565_at:172:159; Interrogation_Position=1504; Antisense; ACACACTTGTGTTACCTGTAGGCTT
>probe:Drosophila_2:1626565_at:550:485; Interrogation_Position=1521; Antisense; GTAGGCTTGTCTTTGACTCCAAGAA
>probe:Drosophila_2:1626565_at:326:207; Interrogation_Position=1547; Antisense; AAGCTGTTTGCCCACCTAAAGAAGA
>probe:Drosophila_2:1626565_at:157:411; Interrogation_Position=1570; Antisense; GACGAACCATGGTGTCTACATACCT
>probe:Drosophila_2:1626565_at:617:201; Interrogation_Position=1601; Antisense; AAGCCTAATGTTGAGGGCAAGCCTC
>probe:Drosophila_2:1626565_at:576:561; Interrogation_Position=1616; Antisense; GGCAAGCCTCCTGGCAAAGCTAAGG
>probe:Drosophila_2:1626565_at:598:359; Interrogation_Position=1641; Antisense; GCAAGCGCAACAAGTAGGGTCGTAT
>probe:Drosophila_2:1626565_at:121:687; Interrogation_Position=1663; Antisense; TATAGATATCCACCCACACCTTGTA
>probe:Drosophila_2:1626565_at:25:55; Interrogation_Position=1744; Antisense; ATGAAGTTAAGTATGCTCGCTCCAA

Paste this into a BLAST search page for me
AAGAAGAATCTTCGCTAGCCAAACGAGGCAAGGAAGTCAGCTGTCAAGCAGCAGTGACGAACCAGATGAGCCAATAGAGCAAACTGTTTCGGAACCGAATGGCAACAGTGGCTCCCAAAAGCGGAACACACTTGTGTTACCTGTAGGCTTGTAGGCTTGTCTTTGACTCCAAGAAAAGCTGTTTGCCCACCTAAAGAAGAGACGAACCATGGTGTCTACATACCTAAGCCTAATGTTGAGGGCAAGCCTCGGCAAGCCTCCTGGCAAAGCTAAGGGCAAGCGCAACAAGTAGGGTCGTATTATAGATATCCACCCACACCTTGTAATGAAGTTAAGTATGCTCGCTCCAA

Full Affymetrix probeset data:

Annotations for 1626565_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime