FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626566_at:

>probe:Drosophila_2:1626566_at:240:69; Interrogation_Position=1029; Antisense; AGGCTGTGCAGTTCATGCTGGCTGA
>probe:Drosophila_2:1626566_at:399:69; Interrogation_Position=1055; Antisense; ATGGCCATCGGTGTGGAGACATCCC
>probe:Drosophila_2:1626566_at:536:527; Interrogation_Position=1104; Antisense; GGGAAATCGACCAGGGACGCCGCAA
>probe:Drosophila_2:1626566_at:448:683; Interrogation_Position=1136; Antisense; TATGCCTCCATTGCCAAGTGCCATG
>probe:Drosophila_2:1626566_at:675:447; Interrogation_Position=1201; Antisense; GATCTTTGGAGGCAACGGCTTCAAC
>probe:Drosophila_2:1626566_at:299:343; Interrogation_Position=1218; Antisense; GCTTCAACAGCGAGTATCCCGTGGA
>probe:Drosophila_2:1626566_at:722:289; Interrogation_Position=1279; Antisense; CGAAGGTACTTCTCAGATCCAGCGC
>probe:Drosophila_2:1626566_at:381:315; Interrogation_Position=1302; Antisense; GCCTCATCATTTCCCGAAACATGTA
>probe:Drosophila_2:1626566_at:38:661; Interrogation_Position=1360; Antisense; TAACTAGGATTCCTCATCTCCATTC
>probe:Drosophila_2:1626566_at:175:131; Interrogation_Position=1385; Antisense; ACCTCATCAGTTGTCATGCTCATTG
>probe:Drosophila_2:1626566_at:183:81; Interrogation_Position=876; Antisense; AGGGTGCCGGTTTCAAAATTGCCAT
>probe:Drosophila_2:1626566_at:637:523; Interrogation_Position=901; Antisense; GGGCACCTTTGATAAGACGCGTCCT
>probe:Drosophila_2:1626566_at:32:263; Interrogation_Position=956; Antisense; CAGCGTTGCTTGGATGAGGCTCTTA
>probe:Drosophila_2:1626566_at:424:439; Interrogation_Position=971; Antisense; GAGGCTCTTAAATACGCGCTGGAAC

Paste this into a BLAST search page for me
AGGCTGTGCAGTTCATGCTGGCTGAATGGCCATCGGTGTGGAGACATCCCGGGAAATCGACCAGGGACGCCGCAATATGCCTCCATTGCCAAGTGCCATGGATCTTTGGAGGCAACGGCTTCAACGCTTCAACAGCGAGTATCCCGTGGACGAAGGTACTTCTCAGATCCAGCGCGCCTCATCATTTCCCGAAACATGTATAACTAGGATTCCTCATCTCCATTCACCTCATCAGTTGTCATGCTCATTGAGGGTGCCGGTTTCAAAATTGCCATGGGCACCTTTGATAAGACGCGTCCTCAGCGTTGCTTGGATGAGGCTCTTAGAGGCTCTTAAATACGCGCTGGAAC

Full Affymetrix probeset data:

Annotations for 1626566_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720