FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626567_at:

>probe:Drosophila_2:1626567_at:615:143; Interrogation_Position=141; Antisense; ACTGTCTAGCGGGAACAACGGAGAG
>probe:Drosophila_2:1626567_at:177:427; Interrogation_Position=161; Antisense; GAGAGGAACGAGCTCCGATTGCCAT
>probe:Drosophila_2:1626567_at:628:117; Interrogation_Position=171; Antisense; AGCTCCGATTGCCATTATGCAGATT
>probe:Drosophila_2:1626567_at:316:351; Interrogation_Position=189; Antisense; GCAGATTCGTATGGCTGATTACCGA
>probe:Drosophila_2:1626567_at:458:249; Interrogation_Position=234; Antisense; CAATTGTTTTGCTGTGACTCCCCGA
>probe:Drosophila_2:1626567_at:48:595; Interrogation_Position=246; Antisense; TGTGACTCCCCGAGTTTTCCATATG
>probe:Drosophila_2:1626567_at:526:683; Interrogation_Position=267; Antisense; TATGCCACACGCGAATGGCCAAGGG
>probe:Drosophila_2:1626567_at:533:183; Interrogation_Position=294; Antisense; AAAAGGTCGGGATAGCGGCATCGTT
>probe:Drosophila_2:1626567_at:306:27; Interrogation_Position=305; Antisense; ATAGCGGCATCGTTATTGTCCCCAT
>probe:Drosophila_2:1626567_at:140:631; Interrogation_Position=332; Antisense; TCCTGGGCCCGGTCAAGTGGCTAGC
>probe:Drosophila_2:1626567_at:296:621; Interrogation_Position=38; Antisense; TGCTGCTCCTTTACAGTTCGTCAAT
>probe:Drosophila_2:1626567_at:9:711; Interrogation_Position=64; Antisense; TTAATGGTTCTTGGGAGGACACACT
>probe:Drosophila_2:1626567_at:444:559; Interrogation_Position=80; Antisense; GGACACACTCGGAAATCGCTGCTAA
>probe:Drosophila_2:1626567_at:667:165; Interrogation_Position=92; Antisense; AAATCGCTGCTAAAAACTCTGCCGC

Paste this into a BLAST search page for me
ACTGTCTAGCGGGAACAACGGAGAGGAGAGGAACGAGCTCCGATTGCCATAGCTCCGATTGCCATTATGCAGATTGCAGATTCGTATGGCTGATTACCGACAATTGTTTTGCTGTGACTCCCCGATGTGACTCCCCGAGTTTTCCATATGTATGCCACACGCGAATGGCCAAGGGAAAAGGTCGGGATAGCGGCATCGTTATAGCGGCATCGTTATTGTCCCCATTCCTGGGCCCGGTCAAGTGGCTAGCTGCTGCTCCTTTACAGTTCGTCAATTTAATGGTTCTTGGGAGGACACACTGGACACACTCGGAAATCGCTGCTAAAAATCGCTGCTAAAAACTCTGCCGC

Full Affymetrix probeset data:

Annotations for 1626567_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720