FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626568_at:

>probe:Drosophila_2:1626568_at:665:271; Interrogation_Position=1083; Antisense; CATATCTGCCTCACATGCAACAAGG
>probe:Drosophila_2:1626568_at:22:549; Interrogation_Position=1115; Antisense; GGAGGCGCAGTTTTTGCATCGGCAC
>probe:Drosophila_2:1626568_at:458:347; Interrogation_Position=1130; Antisense; GCATCGGCACTACTCCACAAAGTAT
>probe:Drosophila_2:1626568_at:708:493; Interrogation_Position=1167; Antisense; GTCAACTTGCTGGTTAATGGTCCAA
>probe:Drosophila_2:1626568_at:74:247; Interrogation_Position=1198; Antisense; AATTCCAGTCTGAAGTCGATCCGGC
>probe:Drosophila_2:1626568_at:170:555; Interrogation_Position=1322; Antisense; GGACCACGAGGTACTTCAGGATGAG
>probe:Drosophila_2:1626568_at:458:551; Interrogation_Position=1397; Antisense; GGAGCTGTACACCTAACTTTAAGCA
>probe:Drosophila_2:1626568_at:338:181; Interrogation_Position=1428; Antisense; AAAAATCGACTGTTGGCGCCACACA
>probe:Drosophila_2:1626568_at:644:155; Interrogation_Position=1464; Antisense; ACACGCCACAATGCCAGGGATGCAA
>probe:Drosophila_2:1626568_at:406:357; Interrogation_Position=1485; Antisense; GCAAACTATCTGACTTTTTCGGTGG
>probe:Drosophila_2:1626568_at:406:395; Interrogation_Position=1516; Antisense; GAAATCCTTTGAATCACCAGCCAGC
>probe:Drosophila_2:1626568_at:675:261; Interrogation_Position=1537; Antisense; CAGCCGTACGATTAGCACCAGTGTG
>probe:Drosophila_2:1626568_at:76:73; Interrogation_Position=1564; Antisense; AGGAATTCAACGTCGGTCTTAGATT
>probe:Drosophila_2:1626568_at:430:689; Interrogation_Position=1612; Antisense; TATTCTAATTGCACAGCGCGCTTAT

Paste this into a BLAST search page for me
CATATCTGCCTCACATGCAACAAGGGGAGGCGCAGTTTTTGCATCGGCACGCATCGGCACTACTCCACAAAGTATGTCAACTTGCTGGTTAATGGTCCAAAATTCCAGTCTGAAGTCGATCCGGCGGACCACGAGGTACTTCAGGATGAGGGAGCTGTACACCTAACTTTAAGCAAAAAATCGACTGTTGGCGCCACACAACACGCCACAATGCCAGGGATGCAAGCAAACTATCTGACTTTTTCGGTGGGAAATCCTTTGAATCACCAGCCAGCCAGCCGTACGATTAGCACCAGTGTGAGGAATTCAACGTCGGTCTTAGATTTATTCTAATTGCACAGCGCGCTTAT

Full Affymetrix probeset data:

Annotations for 1626568_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720