Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626571_at:

>probe:Drosophila_2:1626571_at:190:479; Interrogation_Position=1461; Antisense; GTTTCAGAAACTTCAAGTCCCCGAG
>probe:Drosophila_2:1626571_at:708:501; Interrogation_Position=1477; Antisense; GTCCCCGAGAACTTTGAGCGCACAG
>probe:Drosophila_2:1626571_at:714:449; Interrogation_Position=1513; Antisense; GATCCCGCGGAGCAGTCTGATTATA
>probe:Drosophila_2:1626571_at:18:103; Interrogation_Position=1580; Antisense; AGAGCAATACGTTCTGTGCCACTCT
>probe:Drosophila_2:1626571_at:711:503; Interrogation_Position=1595; Antisense; GTGCCACTCTGGGTATAGACGATCC
>probe:Drosophila_2:1626571_at:256:25; Interrogation_Position=1609; Antisense; ATAGACGATCCGCTGTGCTTAGTTT
>probe:Drosophila_2:1626571_at:197:279; Interrogation_Position=1648; Antisense; CTAGATCTGCCTGCGGTGGGAGCTA
>probe:Drosophila_2:1626571_at:728:211; Interrogation_Position=1724; Antisense; AAGACGTGGCTGAACCATTGGTTAC
>probe:Drosophila_2:1626571_at:197:559; Interrogation_Position=1760; Antisense; GGAAACTTAACTTATCCCTGCCAGC
>probe:Drosophila_2:1626571_at:184:353; Interrogation_Position=1795; Antisense; GCAGCAGCTGATACCACCGATGAAA
>probe:Drosophila_2:1626571_at:201:183; Interrogation_Position=1817; Antisense; AAAACGTGATAGACCTGCCCGAGGA
>probe:Drosophila_2:1626571_at:666:25; Interrogation_Position=1861; Antisense; ATAGCAACGGAAACGCCTCATGTAG
>probe:Drosophila_2:1626571_at:504:483; Interrogation_Position=1882; Antisense; GTAGAGGAACCTGCATCAGTGCCCG
>probe:Drosophila_2:1626571_at:344:507; Interrogation_Position=1900; Antisense; GTGCCCGCTAGTCCCAATGTGAAAA

Paste this into a BLAST search page for me
GTTTCAGAAACTTCAAGTCCCCGAGGTCCCCGAGAACTTTGAGCGCACAGGATCCCGCGGAGCAGTCTGATTATAAGAGCAATACGTTCTGTGCCACTCTGTGCCACTCTGGGTATAGACGATCCATAGACGATCCGCTGTGCTTAGTTTCTAGATCTGCCTGCGGTGGGAGCTAAAGACGTGGCTGAACCATTGGTTACGGAAACTTAACTTATCCCTGCCAGCGCAGCAGCTGATACCACCGATGAAAAAAACGTGATAGACCTGCCCGAGGAATAGCAACGGAAACGCCTCATGTAGGTAGAGGAACCTGCATCAGTGCCCGGTGCCCGCTAGTCCCAATGTGAAAA

Full Affymetrix probeset data:

Annotations for 1626571_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime